skip to primary navigationskip to content
 

Sequences

from DNA Strider Tuesday, August 30, 1994 11:58:17; DNA sequence pP2C2S 22/2/94 9714 b.p. complete sequence ;

gaaaactaaaccatacaccaccaacacaaccaaacccaccacgcccaattgttacacacccgcttgaaaaagaaagttta

acaaatggccaaggtgcgcgaggtttaccaatcttttacagactccaccacaaaaactctcatccaagatgaggcttata

gaaacattcgccccatcatggaaaaacacaaactagctaacccttacgctcaaacggttgaagcggctaatgatctagag

gggttcggcatagccaccaatccctatagcattgaattgcatacacatgcagccgctaagaccatagagaataaacttct

agaggtgcttggttccatcctaccacaagaacctgttacatttatgtttcttaaacccagaaagctaaactacatgagaa

gaaacccgcggatcaaggacattttccaaaatgttgccattgaaccaagagacgtagccaggtaccccaaggaaacaata

attgacaaactcacagagatcacaacggaaacagcatacattagtgacactctgcacttcttggatccgagctacatagt

ggagacattccaaaactgcccaaaattgcaaacattgtatgcgaccttagttctccccgttgaggcagcctttaaaatgg

aaagcactcacccgaacatatacagcctcaaatacttcggagatggtttccagtatataccaggcaaccatggtggcggg

gcataccatcatgaattcgctcatctacaatggctcaaagtgggaaagatcaagtggagggaccccaaggatagctttct

cggacatctcaattacacgactgagcaggttgagatgcacacagtgacagtacagttgcaggaatcgttcgcggcaaacc

acttgtactgcatcaggagaggagacttgctcacaccggaggtgcgcactttcggccaacctgacaggtacgtgattcca

ccacagatcttcctcccaaaagttcacaactgcaagaagccgattctcaagaaaactatgatgcagctcttcttgtatgt

taggacagtcaaggtcgcaaaaaattgtgacatttttgccaaagtcagacaattaattaaatcatctgacttggacaaat

actctgctgtggaactggtttacttagtaagctacatggagttccttgccgatttacaagctaccacctgcttctcagac

acactttctggtggcttgctaacaaagacccttgcaccggtgagggcttggatacaagagaaaaagatgcagctgtttgg

tcttgaggactacgcgaagttagtcaaagcagttgatttccacccggtggatttttctttcaaagtggaaacttgggact

tcagattccaccccttgcaagcgtggaaagccttccgaccaagggaagtgtcggatgtagaggaaatggaaagtttgttc

tcagatggggacctgcttgattgcttcacaagaatgccagcttatgcggtaaacgcagaggaagatttagctgcaatcag

gaaaacgcccgagatggatgtcggtcaagaagttaaagagcctgcaggagacagaaatcaatactcaaaccctgcagaaa

ctttcctcaacaagctccacaggaaacacagtagggaggtgaaacaccaggccgcaaagaaagctaaacgcctagctgaa

atccaggagtcaatgagagctgaaggtgatgccgaaccaaatgaaataagcgggacgatgggggcaatacccagcaacgc

cgaacttcctggcacgaatgatgccagacaagaactcacactcccaaccactaaacctgtccctgcaaggtgggaagatg

cttcattcacagattctagtgtggaagaggagcaggttaaactccttggaaaagaaaccgttgaaacagcgacgcaacaa

gtcatcgaaggacttccttggaaacactggattcctcaattaaatgctgttggattcaaggcgctggaaattcagaggga

taggagtggaacaatgatcatgcccatcacagaaatggtctccgggctggaaaaagaggacttccctgaaggaactccaa

aagagttggcacgagaattgttcgctatgaacagaagccctgccaccatccctttggacctgcttagagccagagactac

ggcagtgatgtaaagaacaagagaattggtgccatcacaaagacacaggcaacgagttggggcgaatacttgacaggaaa

gatagaaagcttaactgagaggaaagttgcgacttgtgtcattcatggagctggaggttctggaaaaagtcatgccatcc

agaaggcattgagagaaattggcaagggctcggacatcactgtagtcctgccgaccaatgaactgcggctagattggagt

aagaaagtgcctaacactgagccctatatgttcaagacctctgaaaaggcgttaattgggggaacaggcagcatagtcat

ctttgacgattactcaaaacttcctcccggttacatagaagccttagtctgtttctactctaaaatcaagctaatcattc

taacaggagatagcagacaaagcgtctaccatgaaactgctgaggacgcctccatcaggcatttgggaccagcaacagag

tacttctcaaaatactgccgatactatctcaatgccacacaccgcaacaagaaagatcttgcgaacatgcttggtgtcta

cagtgagagaacgggagtcaccgaaatcagcatgagcgccgagttcttagaaggaatcccaactttggtaccctcggatg

agaagagaaagctgtacatgggcaccgggaggaatgacacgttcacatacgctggatgccaggggctaactaagccgaag

gtacaaatagtgttggaccacaacacccaagtgtgtagcgcgaatgtgatgtacacggcactttctagagccaccgatag

gattcacttcgtgaacacaagtgcaaattcctctgccttctgggaaaagttggacagcaccccttacctcaagactttcc

tatcagtggtgagagaacaagcactcagggagtacgagccggcagaggcagagccaattcaagagcctgagccccagaca

cacatgtgtgtcgagaatgaggagtccgtgctagaagagtacaaagaggaactcttggaaaagtttgacagagagatcca

ctctgaatcccatggtcattcaaactgtgtccaaactgaagacacaaccattcagttgttttcgcatcaacaagcaaaag

atgagaccctcctctgggcgactatagatgcgcggctcaagaccagcaatcaagaaacaaacttccgagaattcctgagc

aagaaggacattggggacgttctgtttttaaactaccaaaaagctatgggtttacccaaagagcgtattcctttttccca

agaggtctgggaagcttgtgcccacgaagtacaaagcaagtacctcagcaagtcaaagtgcaacttgatcaatgggactg

tgagacagagcccagacttcgatgaaaataagattatggtattcctcaagtcgcagtgggtcacaaaggtggaaaaacta

ggtctacccaagattaagccaggtcaaaccatagcagccttttaccagcagactgtgatgctttttggaactatggctag

gtacatgcgatggttcagacaggctttccagccaaaagaagtcttcataaactgtgagaccacgccagatgacatgtctg

catgggccttgaacaactggaatttcagcagacctagcttggctaatgactacacagctttcgaccagtctcaggatgga

gccatgttgcaatttgaggtgctcaaagccaaacaccactgcataccagaggaaatcattcaggcatacatagatattaa

gactaatgcacagattttcctaggcacgttatcaattatgcgcctgactggtgaaggtcccacttttgatgcaaacactg

agtgcaacatagcttacacccatacaaagtttgacatcccagccggaactgctcaagtttatgcaggagacgactccgca

ctggactgtgttccagaagtgaagcatagtttccacaggcttgaggacaaattactcctaaagtcaaagcctgtaatcac

gcagcaaaagaagggcagttggcctgagttttgtggttggctgatcacaccaaaaggggtgatgaaagacccaattaagc

tccatgttagcttaaaattggctgaagctaagggtgaactcaagaaatgtcaagattcctatgaaattgatctgagttat

gcctatgaccacaaggactctctgcatgacttgttcgatgagaaacagtgtcaggcacacacactcacttgcagaacact

aatcaagtcagggagaggcactgtctcactttcccgcctcagaaactttctttaaccgttaagttaccttagagatttga

ataagatggatattctcatcagtagtttgaaaagtttaggttattctaggacttccaaatctttagattcaggacctttg

gtagtacatgcagtagccggagccggtaagtccacagccctaaggaagttgatcctcagacacccaacattcaccgtgca

tacactcggtgtccctgacaaggtgagtatcagaactagaggcatacagaagccaggacctattcctgagggcaacttcg

caatcctcgatgagtatactttggacaacaccacaaggaactctaaccaggcactttttgctgacccttatcaggcaccg

gagtttagcctagagccccacttctacttggaaacatcatttcgagttccgaggaaagtggcagatttgatagctggctg

tggcttcgatttcgagaccaactcaccggaagaagggcacttagagatcactggcatattcaaagggcccctactcggaa

aggtgatagccattgatgaggagtctgagacaacactgtccaggcatggtgttgagtttgttaagccctgccaagtgacg

ggacttgagttcaaagtagtcactattgtgtctgccgcaccaatagaggaaattggccagtccacagctttctacaacgc

tatcaccaggtcaaagggattgacatatgtccgcgcagggccataggctgaccgctccggtcaattctgaaaaagtgtac

atagtattaggtctatcatttgctttagtttcaattacctttctgctttctagaaatagcttaccccacgtcggtgacaa

cattcacagcttgccacacggaggagcttacagagacggcaccaaagcaatcttgtacaactccccaaatctagggtcac

gagtgagtctacacaacggaaagaacgcagcatttgctgccgttttgctactgactttgctgatctatggaagtaaatac

atatctcaacgcaatcatacttgtgcttgtggtaacaatcatagcagtcattagcacttccttagtgaggactgaacctt

gtgtcatcaagattactggggaatcaatcacagtgttggcttgcaaactagatgcagaaaccataagggccattgccgat

ctcaagccactctccgttgaacggttaagtttccattgatactcgaaagaGGTCAGCACCAGCTAGCATCGATCGCGATA

TCGTCGACCGCCGATgaacggttaagtttccattgatactcgaaagatgtcagcaccagctagcacaacacagcccatag

ggtcaactacctcaactaccacaaaaactgcaggcgcaactcctgccacagcttcaggcctgttcaccatcccggatggg

gatttctttagtacagcccgtgccatagtagccagcaatgctgtcgcaacaaatgaggacctcagcaagattgaggctat

ttggaaggacatgaaggtgcccacagacactatggcacaggctgcttgggacttagtcagacactgtgctgatgtaggat

catccgctcaaacagaaatgatagatacaggtccctattccaacggcatcagcagagctagactggcagcagcaattaaa

gaggtgtgcacacttaggcaattttgcatgaagtatgctccagtggtatggaactggatgttaactaacaacagtccacc

tgctaactggcaagcacaaggtttcaagcctgagcacaaattcgctgcattcgacttcttcaatggagtcaccaacccag

ctgccatcatgcccaaagaggggctcatccggccaccgtctgaagctgaaatgaatgctgcccaaactgctgcctttgtg

aagattacaaaggccagggcacaatccaacgactttgccagcctagatgcagctgtcaCTCGAGGTCGTATCACTGGAAC

AACAACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTCTACATAACCGACGCCTACCCCAGTTTCATAGTA

TTTTCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAAAAAAAAAAACTAGTggtACCGAGCTCggtaccc

catgcaagcttttgttccctttagtgagggttaattccgagcttggcgtaatcatggtcatagctgtttcctgtgtgaaa

ttgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagct

aactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggc

caacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcg

gctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaaca

tgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccct

gacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccc

tggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcg

tggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaa

ccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcc

actggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggccta

actacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagc

tcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagg

atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca

tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgag

taaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagt

tgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgag

acccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaact

ttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgt

tgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaa

ggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttg

gccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt

gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacggg

ataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatc

ttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgt

ttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatac

tcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaa

aataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacatt

aacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgc

agctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgtt

ggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaatacc

gcacagatgcgtaaggagaaaataccgcatcaggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttg

ttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggt

tgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctat

cagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaa

ccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaag

gagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgcta

cagggcgcgtcgcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacg

ccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaa

cgacggccagtgaattgtaatacgactcactata

from DNA Strider Wednesday, August 31, 1994 14:27:32; DNA sequence TXGC3S.VEC 11655 b.p. complete sequence;

GAAAACTAAACCATACACCACCAACACAACCAAACCCACCACGCCCAATTGTTACACACCCGCTTGAAAAAGAAAGTTTA

ACAAATGGCCAAGGTGCGCGAGGTTTACCAATCTTTTACAGACTCCACCACAAAAACTCTCATCCAAGATGAGGCTTATA

GAAACATTCGCCCCATCATGGAAAAACACAAACTAGCTAACCCTTACGCTCAAACGGTTGAAGCGGCTAATGATCTAGAG

GGGTTCGGCATAGCCACCAATCCCTATAGCATTGAATTGCATACACATGCAGCCGCTAAGACCATAGAGAATAAACTTCT

AGAGGTGCTTGGTTCCATCCTACCACAAGAACCTGTTACATTTATGTTTCTTAAACCCAGAAAGCTAAACTACATGAGAA

GAAACCCGCGGATCAAGGACATTTTCCAAAATGTTGCCATTGAACCAAGAGACGTAGCCAGGTACCCCAAGGAAACAATA

ATTGACAAACTCACAGAGATCACAACGGAAACAGCATACATTAGTGACACTCTGCACTTCTTGGATCCGAGCTACATAGT

GGAGACATTCCAAAACTGCCCAAAATTGCAAACATTGTATGCGACCTTAGTTCTCCCCGTTGAGGCAGCCTTTAAAATGG

AAAGCACTCACCCGAACATATACAGCCTCAAATACTTCGGAGATGGTTTCCAGTATATACCAGGCAACCATGGTGGCGGG

GCATACCATCATGAATTCGCTCATCTACAATGGCTCAAAGTGGGAAAGATCAAGTGGAGGGACCCCAAGGATAGCTTTCT

CGGACATCTCAATTACACGACTGAGCAGGTTGAGATGCACACAGTGACAGTACAGTTGCAGGAATCGTTCGCGGCAAACC

ACTTGTACTGCATCAGGAGAGGAGACTTGCTCACACCGGAGGTGCGCACTTTCGGCCAACCTGACAGGTACGTGATTCCA

CCACAGATCTTCCTCCCAAAAGTTCACAACTGCAAGAAGCCGATTCTCAAGAAAACTATGATGCAGCTCTTCTTGTATGT

TAGGACAGTCAAGGTCGCAAAAAATTGTGACATTTTTGCCAAAGTCAGACAATTAATTAAATCATCTGACTTGGACAAAT

ACTCTGCTGTGGAACTGGTTTACTTAGTAAGCTACATGGAGTTCCTTGCCGATTTACAAGCTACCACCTGCTTCTCAGAC

ACACTTTCTGGTGGCTTGCTAACAAAGACCCTTGCACCGGTGAGGGCTTGGATACAAGAGAAAAAGATGCAGCTGTTTGG

TCTTGAGGACTACGCGAAGTTAGTCAAAGCAGTTGATTTCCACCCGGTGGATTTTTCTTTCAAAGTGGAAACTTGGGACT

TCAGATTCCACCCCTTGCAAGCGTGGAAAGCCTTCCGACCAAGGGAAGTGTCGGATGTAGAGGAAATGGAAAGTTTGTTC

TCAGATGGGGACCTGCTTGATTGCTTCACAAGAATGCCAGCTTATGCGGTAAACGCAGAGGAAGATTTAGCTGCAATCAG

GAAAACGCCCGAGATGGATGTCGGTCAAGAAGTTAAAGAGCCTGCAGgagacagaaatcaatactcaaaccCTGCAGAAA

CTTTCCTCAACAAGCTCCACAGGAAACACAGTAGGGAGGTGAAACACCAGGCCGCAAAGAAAGCTAAACGCCTAGCTGAA

ATCCAGGAGTCAATGAGAGCTGAAGGTGATGCCGAACCAAATGAAATAAGCGGGacgaTGGGGGCAATACCCAGCAACGC

CGAACTTCCTGGCACGAATGATGCCAGACAAGAACTCACACTCCCAACCACTAAACCTGTCCCTGCAAGGTGGGAAGATG

CTTCATTCACAGATTCTAGTGTGGAAGAGGAGCAGGTTAAACTCCTTGGAAAAGAAACCGTTGAAACAGCGACGCAACAA

GTCATCGAAGGACTTCCTTGGAAACACTGGATTCCTCAATTAAATGCTGTTGGATTCAAGGCGCTGGAAATTCAGAGGGA

TAGGAGTGGAACAATGATCATGCCCATCACAGAAATGGTCTCCGGGCTGGAAAAAGAGGACTTCCCTGAAGGAACTCCAA

AAGAGTTGGCACGAGAATTGTTCGCTATGAACAGAAGCCCTGCCACCATCCCTTTGGACCTGCTTAGAGCCAGAGACTAC

GGCAGTGATGTAAAGAACAAGAGAATTGGTGCCATCACAAAGACACAGGCAACGAGTTGGGGCGAATACTTGACAGGAAA

GATAGAAAGCTTAACTGAGAGGAAAGTTGCGACTTGTGTCATTCATGGAGCTGGAGGTTCTGGAAAAAGTCATGCCATCC

AGAAGGCATTGAGAGAAATTGGCAAGGGCTCGGACATCACTGTAGTCCTGCCGACCAATGAACTGCGGCTAGATTGGAGT

AAGAAAGTGCCTAACACTGAGCCCTATATGTTCAAGACCTCTGAAAAGGCGTTAATTGGGGGAACAGGCAGCATAGTCAT

CTTTGACGATTACTCAAAACTTCCTCCCGGTTACATAGAAGCCTTAGTCTGTTTCTACTCTAAAATCAAGCTAATCATTC

TAACAGGAGATAGCAGACAAAGCGTCTACCATGAAACTGCTGAGGACGCCTCCATCAGGCATTTGGGACCAGCAACAGAG

TACTTCTCAAAATACTGCCGATACTATCTCAATGCCACACACCGCAACAAGAAAGATCTTGCGAACATGCTTGGTGTCTA

CAGTGAGAGAACGGGAGTCACCGAAATCAGCATGAGCGCCGAGTTCTTAGAAGGAATCCCAACTTTGGTACCCTCGGATG

AGAAGAGAAAGCTGTACATGGGCACCGGGAGGAATGACACGTTCACATACGCTGGATGCCAGGGGCTAACTAAGCCGAAG

GTACAAATAGTGTTGGACCACAACACCCAAGTGTGTAGCGCGAATGTGATGTACACGGCACTTTCTAGAGCCACCGATAG

GATTCACTTCGTGAACACAAGTGCAAATTCCTCTGCCTTCTGGGAAAAGTTGGACAGCACCCCTTACCTCAAGACTTTCC

TATCAGTGGTGAGAGAACAAGCACTCAGGGAGTACGAGCCGGCAGAGGCAGAGCCAATTCAAGAGCCTGAGCCCCAGACA

CACATGTGTGTCGAGAATGAGGAGTCCGTGCTAGAAGAGTACAAAGAGGAACTCTTGGAAAAGTTTGACAGAGAGATCCA

CTCTGAATCCCATGGTCATTCAAACTGTGTCCAAACTGAAGACACAACCATTCAGTTGTTTTCGCATCAACAAGCAAAAG

ATGAGACCCTCCTCTGGGCGACTATAGATGCGCGGCTCAAGACCAGCAATCAAGAAACAAACTTCCGAGAATTCCTGAGC

AAGAAGGACATTGGGGACGTTCTGTTTTTAAACTACCAAAAAGCTATGGGTTTACCCAAAGAGCGTATTCCTTTTTCCCA

AGAGGTCTGGGAAGCTTGTGCCCACGAAGTACAAAGCAAGTACCTCAGCAAGTCAAAGTGCAACTTGATCAATGGGACTG

TGAGACAGAGCCCAGACTTCGATGAAAATAAGATTATGGTATTCCTCAAGTCGCAGTGGGTCACAAAGGTGGAAAAACTA

GGTCTACCCAAGATTAAGCCAGGTCAAACCATAGCAGCCTTTTACCAGCAGACTGTGATGCTTTTTGGAACTATGGCTAG

GTACATGCGATGGTTCAGACAGGCTTTCCAGCCAAAAGAAGTCTTCATAAACTGTGAGACCACGCCAGATGACATGTCTG

CATGGGCCTTGAACAACTGGAATTTCAGCAGACCTAGCTTGGCTAATGACTACACAGCTTTCGACCAGTCTCAGGATGGA

GCCATGTTGCAATTTGAGGTGCTCAAAGCCAAACACCACTGCATACCAGAGGAAATCATTCAGGCATACATAGATATTAA

GACTAATGCACAGATTTTCCTAGGCACGTTATCAATTATGCGCCTGACTGGTGAAGGTCCCACTTTTGATGCAAACACTG

AGTGCAACATAGCTTACACCCATACAAAGTTTGACATCCCAGCCGGAACTGCTCAAGTTTATGCAGGAGACGACTCCGCA

CTGGACTGTGTTCCAGAAGTGAAGCATAGTTTCCACAGGCTTGAGGACAAATTACTCCTAAAGTCAAAGCCTGTAATCAC

GCAGCAAAAGAAGGGCAGTTGGCCTGAGTTTTGTGGTTGGCTGATCACACCAAAAGGGGTGATGAAAGACCCAATTAAGC

TCCATGTTAGCTTAAAATTGGCTGAAGCTAAGGGTGAACTCAAGAAATGTCAAGATTCCTATGAAATTGATCTGAGTTAT

GCCTATGACCACAAGGACTCTCTGCATGACTTGTTCGATGAGAAACAGTGTCAGGCACACACACTCACTTGCAGAACACT

AATCAAGTCAGGGAGAGGCACTGTCTCACTTTCCCGCCTCAGAAACTTTCTTTAACCGTTAAGTTACCTTAGAGATTTGA

ATAAGATGGATATTCTCATCAGTAGTTTGAAAAGTTTAGGTTATTCTAGGACTTCCAAATCTTTAGATTCAGGACCTTTG

GTAGTACATGCAGTAGCCGGAGCCGGTAAGTCCACAGCCCTAAGGAAGTTGATCCTCAGACACCCAACATTCACCGTGCA

TACACTCGGTGTCCCTGACAAGGTGAGTATCAGAACTAGAGGCATACAGAAGCCAGGACCTATTCCTGAGGGCAACTTCG

CAATCCTCGATGAGTATACTTTGGACAACACCACAAGGAACTCTAACCAGGCACTTTTTGCTGACCCTTATCAGGCACCG

GAGTTTAGCCTAGAGCCCCACTTCTACTTGGAAACATCATTTCGAGTTCCGAGGAAAGTGGCAGATTTGATAGCTGGCTG

TGGCTTCGATTTCGAGACCAACTCACCGGAAGAAGGGCACTTAGAGATCACTGGCATATTCAAAGGGCCCCTACTCGGAA

AGGTGATAGCCATTGATGAGGAGTCTGAGACAACACTGTCCAGGCATGGTGTTGAGTTTGTTAAGCCCTGCCAAGTGACG

GGACTTGAGTTCAAAGTAGTCACTATTGTGTCTGCCGCACCAATAGAGGAAATTGGCCAGTCCACAGCTTTCTACAACGC

TATCACCAGGTCAAAGGGATTGACATATGTCCGCGCAGGGCCATAGGCTGACCGCTCCGGTCAATTCTGAAAAAGTGTAC

ATAGTATTAGGTCTATCATTTGCTTTAGTTTCAATTACCTTTCTGCTTTCTAGAAATAGCTTACCCCACGTCGGTGACAA

CATTCACAGCTTGCCACACGGAGGAGCTTACAGAGACGGCACCAAAGCAATCTTGTACAACTCCCCAAATCTAGGGTCAC

GAGTGAGTCTACACAACGGAAAGAACGCAGCATTTGCTGCCGTTTTGCTACTGACTTTGCTGATCTATGGAAGTAAATAC

ATATCTCAACGCAATCATACTTGTGCTTGTGGTAACAATCATAGCAGTCATTAGCACTTCCTTAGTGAGGACTGAACCTT

GTGTCATCAAGATTACTGGGGAATCAATCACAGTGTTGGCTTGCAAACTAGATGCAGAAACCATAAGGGCCATTGCCGAT

CTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGCTAGAGGATCCCCGGGTG

GTCAGTCCCTTATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTG

GATCGCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGCTGTGCCAGGCAG

TTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAAGTCTTTATACCGA

AAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAAAGTGTGGGTCAATAATCAGGAA

GTGATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTAT

CACCGTTTGTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGAAAACGGCAAGAAAA

AGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGCCGAACACCTGG

GTGGACGATATCACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCGTCTGTTGACTGGCAGGTGGTGGCCAATGG

TGATGTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGACTTTGCAAGTGG

TGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGTGCGTCACAGCCAAAAGCCAGACAGAGTGTGAT

ATCTACCCGCTTCGCGTCGGCATCCGGTCAGTGGCAGTGAAGGGCCAACAGTTCCTGATTAACCACAAACCGTTCTACTT

TACTGGCTTTGGTCGTCATGAAGATGCGGACTTACGTGGCAAAGGATTCGATAACGTGCTGATGGTGCACGACCACGCAT

TAATGGACTGGATTGGGGCCAACTCCTACCGTACCTCGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAA

CATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTCGAAGCGGGCAACAA

GCCGAAAGAACTGTACAGCGAAGAGGCAGTCAACGGGGAAACTCAGCAAGCGCACTTACAGGCGATTAAAGAGCTGATAG

CGCGTGACAAAAACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACGAACCGGATACCCGTCCGCAAGTGCACGGGAAT

ATTTCGCCACTGGCGGAAGCAACGCGTAAACTCGACCCGACGCGTCCGATCACCTGCGTCAATGTAATGTTCTGCGACGC

TCACACCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCGTTATTACGGATGGTATGTCCAAAGCGGCGATT

TGGAAACGGCAGAGAAGGTACTGGAAAAAGAACTTCTGGCCTGGCAGGAGAAACTGCATCAGCCGATTATCATCACCGAA

TACGGCGTGGATACGTTAGCCGGGCTGCACTCAATGTACACCGACATGTGGAGTGAAGAGTATCAGTGTGCATGGCTGGA

TATGTATCACCGCGTCTTTGATCGCGTCAGCGCCGTCGTCGGTGAACAGGTATGGAATTTCGCCGATTTTGCGACCTCGC

AAGGCATATTGCGCGTTGGCGGTAACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGCGGCTTTTCTGCTG

CAAAAACGCTGGACTGGCATGAACTTCGGTGAAAAACCGCAGCAGGGAGGCAAACAATGAATCAACAACTCTCCTGGCGC

ACCATCGTCGGCTACAGCCTCGGGAATTGCTACCGATCAAGCTTATCGATAAGCTTGATAGGGCCATTGCCGATCTCAAG

CCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGCTAGCACAACACAGCCCATAGGGT

CAACTACCTCAACTACCACAAAAACTGCAGGCGCAACTCCTGCCACAGCTTCAGGCCTGTTCACCATCCCGGATGGGGAT

TTCTTTAGTACAGCCCGTGCCATAGTAGCCAGCAATGCTGTCGCAACAAATGAGGACCTCAGCAAGATTGAGGCTATTTG

GAAGGACATGAAGGTGCCCACAGACACTATGGCACAGGCTGCTTGGGACTTAGTCAGACACTGTGCTGATGTAGGATCAT

CCGCTCAAACAGAAATGATAGATACAGGTCCCTATTCCAACGGCATCAGCAGAGCTAGACTGGCAGCAGCAATTAAAGAG

GTGTGCACACTTAGGCAATTTTGCATGAAGTATGCTCCAGTGGTATGGAACTGGATGTTAACTAACAACaGTCCACCTGC

TAACTGGCAAGCACAAGGTTTCAAGCCTGAGCACAAATTCGCTGCATTCGACTTCTTCAATGGAGTCACCAACCCAGCTG

CCATCATGCCCAAAGAGGGGCTCATCCGGCCACCGTCTGAAGCTGAAATGAATGCTGCCCAAACTGCTGCCTTTGTGAAG

ATTACAAAGGCCAGGGCACAATCCAACGACTTTGCCAGCCTAGATGCAGCTGTCACTCGAGGTCGTATCACTGGAACAAC

AACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTCTACATAACCGACGCCTACCCCAGTTTCATAGTATTT

TCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAAAAAAAAAAACTAGTACCGAGCTCGGTACCCGGGGAT

CCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGTTCCCTTTAGTGAGGGTTAATTCCGAGCTTGGCGTAATCATGGTC

ATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCT

GGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGC

CAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGA

CTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAG

GGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTT

TTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATA

AAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCG

CCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCC

AAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCC

GGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAG

AGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACC

TTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA

GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACT

CACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAA

TCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTG

TCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCA

GTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAG

CGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCC

AGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCA

GCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCG

ATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCC

ATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCT

CTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCG

GGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGC

ATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACAC

GGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC

ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGA

AACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACG

GTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGT

CAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCA

CCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAACGTTAATATTTTGTT

AAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAA

AAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTC

AAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTG

CCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAA

AGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCC

GCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGT

GCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTT

CCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATA

from DNA Strider Tuesday, October 3, 1995 9:10:12 am; DNA sequence pTXS-GFP 10491 b.p. complete sequence;

GAAAACTAAACCATACACCACCAACACAACCAAACCCACCACGCCCAATTGTTACACACCCGCTTGAAAAAGAAAGTTTA

ACAAATGGCCAAGGTGCGCGAGGTTTACCAATCTTTTACAGACTCCACCACAAAAACTCTCATCCAAGATGAGGCTTATA

GAAACATTCGCCCCATCATGGAAAAACACAAACTAGCTAACCCTTACGCTCAAACGGTTGAAGCGGCTAATGATCTAGAG

GGGTTCGGCATAGCCACCAATCCCTATAGCATTGAATTGCATACACATGCAGCCGCTAAGACCATAGAGAATAAACTTCT

AGAGGTGCTTGGTTCCATCCTACCACAAGAACCTGTTACATTTATGTTTCTTAAACCCAGAAAGCTAAACTACATGAGAA

GAAACCCGCGGATCAAGGACATTTTCCAAAATGTTGCCATTGAACCAAGAGACGTAGCCAGGTACCCCAAGGAAACAATA

ATTGACAAACTCACAGAGATCACAACGGAAACAGCATACATTAGTGACACTCTGCACTTCTTGGATCCGAGCTACATAGT

GGAGACATTCCAAAACTGCCCAAAATTGCAAACATTGTATGCGACCTTAGTTCTCCCCGTTGAGGCAGCCTTTAAAATGG

AAAGCACTCACCCGAACATATACAGCCTCAAATACTTCGGAGATGGTTTCCAGTATATACCAGGCAACCATGGTGGCGGG

GCATACCATCATGAATTCGCTCATCTACAATGGCTCAAAGTGGGAAAGATCAAGTGGAGGGACCCCAAGGATAGCTTTCT

CGGACATCTCAATTACACGACTGAGCAGGTTGAGATGCACACAGTGACAGTACAGTTGCAGGAATCGTTCGCGGCAAACC

ACTTGTACTGCATCAGGAGAGGAGACTTGCTCACACCGGAGGTGCGCACTTTCGGCCAACCTGACAGGTACGTGATTCCA

CCACAGATCTTCCTCCCAAAAGTTCACAACTGCAAGAAGCCGATTCTCAAGAAAACTATGATGCAGCTCTTCTTGTATGT

TAGGACAGTCAAGGTCGCAAAAAATTGTGACATTTTTGCCAAAGTCAGACAATTAATTAAATCATCTGACTTGGACAAAT

ACTCTGCTGTGGAACTGGTTTACTTAGTAAGCTACATGGAGTTCCTTGCCGATTTACAAGCTACCACCTGCTTCTCAGAC

ACACTTTCTGGTGGCTTGCTAACAAAGACCCTTGCACCGGTGAGGGCTTGGATACAAGAGAAAAAGATGCAGCTGTTTGG

TCTTGAGGACTACGCGAAGTTAGTCAAAGCAGTTGATTTCCACCCGGTGGATTTTTCTTTCAAAGTGGAAACTTGGGACT

TCAGATTCCACCCCTTGCAAGCGTGGAAAGCCTTCCGACCAAGGGAAGTGTCGGATGTAGAGGAAATGGAAAGTTTGTTC

TCAGATGGGGACCTGCTTGATTGCTTCACAAGAATGCCAGCTTATGCGGTAAACGCAGAGGAAGATTTAGCTGCAATCAG

GAAAACGCCCGAGATGGATGTCGGTCAAGAAGTTAAAGAGCCTGCAGGAGACAGAAATCAATACTCAAACCCTGCAGAAA

CTTTCCTCAACAAGCTCCACAGGAAACACAGTAGGGAGGTGAAACACCAGGCCGCAAAGAAAGCTAAACGCCTAGCTGAA

ATCCAGGAGTCAATGAGAGCTGAAGGTGATGCCGAACCAAATGAAATAAGCGGGACGATGGGGGCAATACCCAGCAACGC

CGAACTTCCTGGCACGAATGATGCCAGACAAGAACTCACACTCCCAACCACTAAACCTGTCCCTGCAAGGTGGGAAGATG

CTTCATTCACAGATTCTAGTGTGGAAGAGGAGCAGGTTAAACTCCTTGGAAAAGAAACCGTTGAAACAGCGACGCAACAA

GTCATCGAAGGACTTCCTTGGAAACACTGGATTCCTCAATTAAATGCTGTTGGATTCAAGGCGCTGGAAATTCAGAGGGA

TAGGAGTGGAACAATGATCATGCCCATCACAGAAATGGTCTCCGGGCTGGAAAAAGAGGACTTCCCTGAAGGAACTCCAA

AAGAGTTGGCACGAGAATTGTTCGCTATGAACAGAAGCCCTGCCACCATCCCTTTGGACCTGCTTAGAGCCAGAGACTAC

GGCAGTGATGTAAAGAACAAGAGAATTGGTGCCATCACAAAGACACAGGCAACGAGTTGGGGCGAATACTTGACAGGAAA

GATAGAAAGCTTAACTGAGAGGAAAGTTGCGACTTGTGTCATTCATGGAGCTGGAGGTTCTGGAAAAAGTCATGCCATCC

AGAAGGCATTGAGAGAAATTGGCAAGGGCTCGGACATCACTGTAGTCCTGCCGACCAATGAACTGCGGCTAGATTGGAGT

AAGAAAGTGCCTAACACTGAGCCCTATATGTTCAAGACCTCTGAAAAGGCGTTAATTGGGGGAACAGGCAGCATAGTCAT

CTTTGACGATTACTCAAAACTTCCTCCCGGTTACATAGAAGCCTTAGTCTGTTTCTACTCTAAAATCAAGCTAATCATTC

TAACAGGAGATAGCAGACAAAGCGTCTACCATGAAACTGCTGAGGACGCCTCCATCAGGCATTTGGGACCAGCAACAGAG

TACTTCTCAAAATACTGCCGATACTATCTCAATGCCACACACCGCAACAAGAAAGATCTTGCGAACATGCTTGGTGTCTA

CAGTGAGAGAACGGGAGTCACCGAAATCAGCATGAGCGCCGAGTTCTTAGAAGGAATCCCAACTTTGGTACCCTCGGATG

AGAAGAGAAAGCTGTACATGGGCACCGGGAGGAATGACACGTTCACATACGCTGGATGCCAGGGGCTAACTAAGCCGAAG

GTACAAATAGTGTTGGACCACAACACCCAAGTGTGTAGCGCGAATGTGATGTACACGGCACTTTCTAGAGCCACCGATAG

GATTCACTTCGTGAACACAAGTGCAAATTCCTCTGCCTTCTGGGAAAAGTTGGACAGCACCCCTTACCTCAAGACTTTCC

TATCAGTGGTGAGAGAACAAGCACTCAGGGAGTACGAGCCGGCAGAGGCAGAGCCAATTCAAGAGCCTGAGCCCCAGACA

CACATGTGTGTCGAGAATGAGGAGTCCGTGCTAGAAGAGTACAAAGAGGAACTCTTGGAAAAGTTTGACAGAGAGATCCA

CTCTGAATCCCATGGTCATTCAAACTGTGTCCAAACTGAAGACACAACCATTCAGTTGTTTTCGCATCAACAAGCAAAAG

ATGAGACCCTCCTCTGGGCGACTATAGATGCGCGGCTCAAGACCAGCAATCAAGAAACAAACTTCCGAGAATTCCTGAGC

AAGAAGGACATTGGGGACGTTCTGTTTTTAAACTACCAAAAAGCTATGGGTTTACCCAAAGAGCGTATTCCTTTTTCCCA

AGAGGTCTGGGAAGCTTGTGCCCACGAAGTACAAAGCAAGTACCTCAGCAAGTCAAAGTGCAACTTGATCAATGGGACTG

TGAGACAGAGCCCAGACTTCGATGAAAATAAGATTATGGTATTCCTCAAGTCGCAGTGGGTCACAAAGGTGGAAAAACTA

GGTCTACCCAAGATTAAGCCAGGTCAAACCATAGCAGCCTTTTACCAGCAGACTGTGATGCTTTTTGGAACTATGGCTAG

GTACATGCGATGGTTCAGACAGGCTTTCCAGCCAAAAGAAGTCTTCATAAACTGTGAGACCACGCCAGATGACATGTCTG

CATGGGCCTTGAACAACTGGAATTTCAGCAGACCTAGCTTGGCTAATGACTACACAGCTTTCGACCAGTCTCAGGATGGA

GCCATGTTGCAATTTGAGGTGCTCAAAGCCAAACACCACTGCATACCAGAGGAAATCATTCAGGCATACATAGATATTAA

GACTAATGCACAGATTTTCCTAGGCACGTTATCAATTATGCGCCTGACTGGTGAAGGTCCCACTTTTGATGCAAACACTG

AGTGCAACATAGCTTACACCCATACAAAGTTTGACATCCCAGCCGGAACTGCTCAAGTTTATGCAGGAGACGACTCCGCA

CTGGACTGTGTTCCAGAAGTGAAGCATAGTTTCCACAGGCTTGAGGACAAATTACTCCTAAAGTCAAAGCCTGTAATCAC

GCAGCAAAAGAAGGGCAGTTGGCCTGAGTTTTGTGGTTGGCTGATCACACCAAAAGGGGTGATGAAAGACCCAATTAAGC

TCCATGTTAGCTTAAAATTGGCTGAAGCTAAGGGTGAACTCAAGAAATGTCAAGATTCCTATGAAATTGATCTGAGTTAT

GCCTATGACCACAAGGACTCTCTGCATGACTTGTTCGATGAGAAACAGTGTCAGGCACACACACTCACTTGCAGAACACT

AATCAAGTCAGGGAGAGGCACTGTCTCACTTTCCCGCCTCAGAAACTTTCTTTAACCGTTAAGTTACCTTAGAGATTTGA

ATAAGATGGATATTCTCATCAGTAGTTTGAAAAGTTTAGGTTATTCTAGGACTTCCAAATCTTTAGATTCAGGACCTTTG

GTAGTACATGCAGTAGCCGGAGCCGGTAAGTCCACAGCCCTAAGGAAGTTGATCCTCAGACACCCAACATTCACCGTGCA

TACACTCGGTGTCCCTGACAAGGTGAGTATCAGAACTAGAGGCATACAGAAGCCAGGACCTATTCCTGAGGGCAACTTCG

CAATCCTCGATGAGTATACTTTGGACAACACCACAAGGAACTCTAACCAGGCACTTTTTGCTGACCCTTATCAGGCACCG

GAGTTTAGCCTAGAGCCCCACTTCTACTTGGAAACATCATTTCGAGTTCCGAGGAAAGTGGCAGATTTGATAGCTGGCTG

TGGCTTCGATTTCGAGACCAACTCACCGGAAGAAGGGCACTTAGAGATCACTGGCATATTCAAAGGGCCCCTACTCGGAA

AGGTGATAGCCATTGATGAGGAGTCTGAGACAACACTGTCCAGGCATGGTGTTGAGTTTGTTAAGCCCTGCCAAGTGACG

GGACTTGAGTTCAAAGTAGTCACTATTGTGTCTGCCGCACCAATAGAGGAAATTGGCCAGTCCACAGCTTTCTACAACGC

TATCACCAGGTCAAAGGGATTGACATATGTCCGCGCAGGGCCATAGGCTGACCGCTCCGGTCAATTCTGAAAAAGTGTAC

ATAGTATTAGGTCTATCATTTGCTTTAGTTTCAATTACCTTTCTGCTTTCTAGAAATAGCTTACCCCACGTCGGTGACAA

CATTCACAGCTTGCCACACGGAGGAGCTTACAGAGACGGCACCAAAGCAATCTTGTACAACTCCCCAAATCTAGGGTCAC

GAGTGAGTCTACACAACGGAAAGAACGCAGCATTTGCTGCCGTTTTGCTACTGACTTTGCTGATCTATGGAAGTAAATAC

ATATCTCAACGCAATCATACTTGTGCTTGTGGTAACAATCATAGCAGTCATTAGCACTTCCTTAGTGAGGACTGAACCTT

GTGTCATCAAGATTACTGGGGAATCAATCACAGTGTTGGCTTGCAAACTAGATGCAGAAACCATAAGGGCCATTGCCGAT

CTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGAGGTCAGCACCAGCTAGCatcgatCatgagt

aaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgt

cagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttc

catggccaacacttgtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacagcatgac

tttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacg

tgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaaca

ttcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaa

gttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattgg

cgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagag

accacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataaatgtcgacC

GCCGATAAGCTTGATAGGGCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGA

TGTCAGCACCAGCTAGCACAACACAGCCCATAGGGTCAACTACCTCAACTACCACAAAAACTGCAGGCGCAACTCCTGCC

ACAGCTTCAGGCCTGTTCACCATCCCGGATGGGGATTTCTTTAGTACAGCCCGTGCCATAGTAGCCAGCAATGCTGTCGC

AACAAATGAGGACCTCAGCAAGATTGAGGCTATTTGGAAGGACATGAAGGTGCCCACAGACACTATGGCACAGGCTGCTT

GGGACTTAGTCAGACACTGTGCTGATGTAGGATCATCCGCTCAAACAGAAATGATAGATACAGGTCCCTATTCCAACGGC

ATCAGCAGAGCTAGACTGGCAGCAGCAATTAAAGAGGTGTGCACACTTAGGCAATTTTGCATGAAGTATGCTCCAGTGGT

ATGGAACTGGATGTTAACTAACAACAGTCCACCTGCTAACTGGCAAGCACAAGGTTTCAAGCCTGAGCACAAATTCGCTG

CATTCGACTTCTTCAATGGAGTCACCAACCCAGCTGCCATCATGCCCAAAGAGGGGCTCATCCGGCCACCGTCTGAAGCT

GAAATGAATGCTGCCCAAACTGCTGCCTTTGTGAAGATTACAAAGGCCAGGGCACAATCCAACGACTTTGCCAGCCTAGA

TGCAGCTGTCACTCGAGGTCGTATCACTGGAACAACAACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTC

TACATAACCGACGCCTACCCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAA

AAAAAAAAACTAGTACCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGTTCCCTTTA

GTGAGGGTTAATTCCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCAC

ACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGC

TCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTT

GCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC

ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAG

GCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACG

CTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTC

CTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGC

TGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTG

CGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACA

GGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACA

GTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCAC

CGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCT

TTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTC

ACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCA

ATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGA

TAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGAT

TTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTAT

TAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCG

TGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATG

TTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGT

TATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGT

CATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGA

ACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTC

GATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAA

GGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGA

AGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG

CACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCA

CGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCT

TGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAA

CTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAAT

ACCGCATCAGGAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACC

AATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAAC

AAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGA

ACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTA

GAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCA

AGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCGCC

ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTG

CTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATAC

GACTCACTATA

pPVX201-please use this as a working guide

gaaaactaaaccatacaccaccaacacaaccaaacccaccacgcccaattgttacacacccgcttgaaaaagaaagttta

acaaatggccaaggtgcgcgaggtttaccaatcttttacagactccaccacaaaaactctcatccaagatgaggcttata

gaaacattcgccccatcatggaaaaacacaaactagctaacccttacgctcaaacggttgaagcggctaatgatctagag

gggttcggcatagccaccaatccctatagcattgaattgcatacacatgcagccgctaagaccatagagaataaacttct

agaggtgcttggttccatcctaccacaagaacctgttacatttatgtttcttaaacccagaaagctaaactacatgagaa

gaaacccgcggatcaaggacattttccaaaatgttgccattgaaccaagagacgtagccaggtaccccaaggaaacaata

attgacaaactcacagagatcacaacggaaacagcatacattagtgacactctgcacttcttggatccgagctacatagt

ggagacattccaaaactgcccaaaattgcaaacattgtatgcgaccttagttctccccgttgaggcagcctttaaaatgg

aaagcactcacccgaacatatacagcctcaaatacttcggagatggtttccagtatataccaggcaaccatggtggcggg

gcataccatcatgaattcgctcatctacaatggctcaaagtgggaaagatcaagtggagggaccccaaggatagctttct

cggacatctcaattacacgactgagcaggttgagatgcacacagtgacagtacagttgcaggaatcgttcgcggcaaacc

acttgtactgcatcaggagaggagacttgctcacaccggaggtgcgcactttcggccaacctgacaggtacgtgattcca

ccacagatcttcctcccaaaagttcacaactgcaagaagccgattctcaagaaaactatgatgcagctcttcttgtatgt

taggacagtcaaggtcgcaaaaaattgtgacatttttgccaaagtcagacaattaattaaatcatctgacttggacaaat

actctgctgtggaactggtttacttagtaagctacatggagttccttgccgatttacaagctaccacctgcttctcagac

acactttctggtggcttgctaacaaagacccttgcaccggtgagggcttggatacaagagaaaaagatgcagctgtttgg

tcttgaggactacgcgaagttagtcaaagcagttgatttccacccggtggatttttctttcaaagtggaaacttgggact

tcagattccaccccttgcaagcgtggaaagccttccgaccaagggaagtgtcggatgtagaggaaatggaaagtttgttc

tcagatggggacctgcttgattgcttcacaagaatgccagcttatgcggtaaacgcagaggaagatttagctgcaatcag

gaaaacgcccgagatggatgtcggtcaagaagttaaagagcctgcaggagacagaaatcaatactcaaaccctgcagaaa

ctttcctcaacaagctccacaggaaacacagtagggaggtgaaacaccaggccgcaaagaaagctaaacgcctagctgaa

atccaggagtcaatgagagctgaaggtgatgccgaaccaaatgaaataagcgggacgatgggggcaatacccagcaacgc

cgaacttcctggcacgaatgatgccagacaagaactcacactcccaaccactaaacctgtccctgcaaggtgggaagatg

cttcattcacagattctagtgtggaagaggagcaggttaaactccttggaaaagaaaccgttgaaacagcgacgcaacaa

gtcatcgaaggacttccttggaaacactggattcctcaattaaatgctgttggattcaaggcgctggaaattcagaggga

taggagtggaacaatgatcatgcccatcacagaaatggtctccgggctggaaaaagaggacttccctgaaggaactccaa

aagagttggcacgagaattgttcgctatgaacagaagccctgccaccatccctttggacctgcttagagccagagactac

ggcagtgatgtaaagaacaagagaattggtgccatcacaaagacacaggcaacgagttggggcgaatacttgacaggaaa

gatagaaagcttaactgagaggaaagttgcgacttgtgtcattcatggagctggaggttctggaaaaagtcatgccatcc

agaaggcattgagagaaattggcaagggctcggacatcactgtagtcctgccgaccaatgaactgcggctagattggagt

aagaaagtgcctaacactgagccctatatgttcaagacctctgaaaaggcgttaattgggggaacaggcagcatagtcat

ctttgacgattactcaaaacttcctcccggttacatagaagccttagtctgtttctactctaaaatcaagctaatcattc

taacaggagatagcagacaaagcgtctaccatgaaactgctgaggacgcctccatcaggcatttgggaccagcaacagag

tacttctcaaaatactgccgatactatctcaatgccacacaccgcaacaagaaagatcttgcgaacatgcttggtgtcta

cagtgagagaacgggagtcaccgaaatcagcatgagcgccgagttcttagaaggaatcccaactttggtaccctcggatg

agaagagaaagctgtacatgggcaccgggaggaatgacacgttcacatacgctggatgccaggggctaactaagccgaag

gtacaaatagtgttggaccacaacacccaagtgtgtagcgcgaatgtgatgtacacggcactttctagagccaccgatag

gattcacttcgtgaacacaagtgcaaattcctctgccttctgggaaaagttggacagcaccccttacctcaagactttcc

tatcagtggtgagagaacaagcactcagggagtacgagccggcagaggcagagccaattcaagagcctgagccccagaca

cacatgtgtgtcgagaatgaggagtccgtgctagaagagtacaaagaggaactcttggaaaagtttgacagagagatcca

ctctgaatcccatggtcattcaaactgtgtccaaactgaagacacaaccattcagttgttttcgcatcaacaagcaaaag

atgagaccctcctctgggcgactatagatgcgcggctcaagaccagcaatcaagaaacaaacttccgagaattcctgagc

aagaaggacattggggacgttctgtttttaaactaccaaaaagctatgggtttacccaaagagcgtattcctttttccca

agaggtctgggaagcttgtgcccacgaagtacaaagcaagtacctcagcaagtcaaagtgcaacttgatcaatgggactg

tgagacagagcccagacttcgatgaaaataagattatggtattcctcaagtcgcagtgggtcacaaaggtggaaaaacta

ggtctacccaagattaagccaggtcaaaccatagcagccttttaccagcagactgtgatgctttttggaactatggctag

gtacatgcgatggttcagacaggctttccagccaaaagaagtcttcataaactgtgagaccacgccagatgacatgtctg

catgggccttgaacaactggaatttcagcagacctagcttggctaatgactacacagctttcgaccagtctcaggatgga

gccatgttgcaatttgaggtgctcaaagccaaacaccactgcataccagaggaaatcattcaggcatacatagatattaa

gactaatgcacagattttcctaggcacgttatcaattatgcgcctgactggtgaaggtcccacttttgatgcaaacactg

agtgcaacatagcttacacccatacaaagtttgacatcccagccggaactgctcaagtttatgcaggagacgactccgca

ctggactgtgttccagaagtgaagcatagtttccacaggcttgaggacaaattactcctaaagtcaaagcctgtaatcac

gcagcaaaagaagggcagttggcctgagttttgtggttggctgatcacaccaaaaggggtgatgaaagacccaattaagc

tccatgttagcttaaaattggctgaagctaagggtgaactcaagaaatgtcaagattcctatgaaattgatctgagttat

gcctatgaccacaaggactctctgcatgacttgttcgatgagaaacagtgtcaggcacacacactcacttgcagaacact

aatcaagtcagggagaggcactgtctcactttcccgcctcagaaactttctttaaccgttaagttaccttagagatttga

ataagatggatattctcatcagtagtttgaaaagtttaggttattctaggacttccaaatctttagattcaggacctttg

gtagtacatgcagtagccggagccggtaagtccacagccctaaggaagttgatcctcagacacccaacattcaccgtgca

tacactcggtgtccctgacaaggtgagtatcagaactagaggcatacagaagccaggacctattcctgagggcaacttcg

caatcctcgatgagtatactttggacaacaccacaaggaactctaaccaggcactttttgctgacccttatcaggcaccg

gagtttagcctagagccccacttctacttggaaacatcatttcgagttccgaggaaagtggcagatttgatagctggctg

tggcttcgatttcgagaccaactcaccggaagaagggcacttagagatcactggcatattcaaagggcccctactcggaa

aggtgatagccattgatgaggagtctgagacaacactgtccaggcatggtgttgagtttgttaagccctgccaagtgacg

ggacttgagttcaaagtagtcactattgtgtctgccgcaccaatagaggaaattggccagtccacagctttctacaacgc

tatcaccaggtcaaagggattgacatatgtccgcgcagggccataggctgaccgctccggtcaattctgaaaaagtgtac

atagtattaggtctatcatttgctttagtttcaattacctttctgctttctagaaatagcttaccccacgtcggtgacaa

cattcacagcttgccacacggaggagcttacagagacggcaccaaagcaatcttgtacaactccccaaatctagggtcac

gagtgagtctacacaacggaaagaacgcagcatttgctgccgttttgctactgactttgctgatctatggaagtaaatac

atatctcaacgcaatcatacttgtgcttgtggtaacaatcatagcagtcattagcacttccttagtgaggactgaacctt

gtgtcatcaagattactggggaatcaatcacagtgttggcttgcaaactagatgcagaaaccataagggccattgccgat

ctcaagccactctccgttgaacggttaagtttccattgatactcgaaagaGGTCAGCACCAGCTAGCATCGATCGCGATA

TCGTCGACCGCCGATgaacggttaagtttccattgatactcgaaagatgtcagcaccagctagcacaacacagcccatag

ggtcaactacctcaactaccacaaaaactgcaggcgcaactcctgccacagcttcaggcctgttcaccatcccggatggg

gatttctttagtacagcccgtgccatagtagccagcaatgctgtcgcaacaaatgaggacctcagcaagattgaggctat

ttggaaggacatgaaggtgcccacagacactatggcacaggctgcttgggacttagtcagacactgtgctgatgtaggat

catccgctcaaacagaaatgatagatacaggtccctattccaacggcatcagcagagctagactggcagcagcaattaaa

gaggtgtgcacacttaggcaattttgcatgaagtatgctccagtggtatggaactggatgttaactaacaacagtccacc

tgctaactggcaagcacaaggtttcaagcctgagcacaaattcgctgcattcgacttcttcaatggagtcaccaacccag

ctgccatcatgcccaaagaggggctcatccggccaccgtctgaagctgaaatgaatgctgcccaaactgctgcctttgtg

aagattacaaaggccagggcacaatccaacgactttgccagcctagatgcagctgtcaCTCGAGGTCGTATCACTGGAAC

AACAACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTCTACATAACCGACGCCTACCCCAGTTTCATAGTA

TTTTCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAAAAAAAAAAACTAGTggtACCGAGCTCGATCGTT

CAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAAT

TACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATT

ATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTAC

TAGATCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAG

CACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAAT

GGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTAC

AATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGC

TCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAA

CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGG

TGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGA

GACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATT

CCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTT

GGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTC

CAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGC

CGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAG

AGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGG

AGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATA

CCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTAC

TCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGG

CTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGT

AAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGAT

AGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATT

TTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCAC

TGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAAC

AAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA

GCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCT

ACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCT

ACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCG

GTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG

GTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACG

CGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGAT

AACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGA

AGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTC

CCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTT

ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGC

CAAGCTTGCATGCCTGCAGGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAG

AAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGT

CACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGA

AGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCA

CGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGAC

CCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA

pvx cDNA in 35s plasmid construct. PVX begins at 1-the 35s and nos ter junctions are uncharacterised.

The Department has carried out a comprehensive COVID-19 risk assessment process and has opened to allow research work to take place. To ensure the safety of our staff, a range of measures to reduce building occupancy and allow strict social distancing have been introduced, including increased cleaning and hygiene regimes. We are currently not accepting visitors so please continue to contact us by email until further notice.