skip to primary navigationskip to content
 

Sequences

from DNA Strider Tuesday, August 30, 1994 11:58:17; DNA sequence pP2C2S 22/2/94 9714 b.p. complete sequence ;

gaaaactaaaccatacaccaccaacacaaccaaacccaccacgcccaattgttacacacccgcttgaaaaagaaagttta

acaaatggccaaggtgcgcgaggtttaccaatcttttacagactccaccacaaaaactctcatccaagatgaggcttata

gaaacattcgccccatcatggaaaaacacaaactagctaacccttacgctcaaacggttgaagcggctaatgatctagag

gggttcggcatagccaccaatccctatagcattgaattgcatacacatgcagccgctaagaccatagagaataaacttct

agaggtgcttggttccatcctaccacaagaacctgttacatttatgtttcttaaacccagaaagctaaactacatgagaa

gaaacccgcggatcaaggacattttccaaaatgttgccattgaaccaagagacgtagccaggtaccccaaggaaacaata

attgacaaactcacagagatcacaacggaaacagcatacattagtgacactctgcacttcttggatccgagctacatagt

ggagacattccaaaactgcccaaaattgcaaacattgtatgcgaccttagttctccccgttgaggcagcctttaaaatgg

aaagcactcacccgaacatatacagcctcaaatacttcggagatggtttccagtatataccaggcaaccatggtggcggg

gcataccatcatgaattcgctcatctacaatggctcaaagtgggaaagatcaagtggagggaccccaaggatagctttct

cggacatctcaattacacgactgagcaggttgagatgcacacagtgacagtacagttgcaggaatcgttcgcggcaaacc

acttgtactgcatcaggagaggagacttgctcacaccggaggtgcgcactttcggccaacctgacaggtacgtgattcca

ccacagatcttcctcccaaaagttcacaactgcaagaagccgattctcaagaaaactatgatgcagctcttcttgtatgt

taggacagtcaaggtcgcaaaaaattgtgacatttttgccaaagtcagacaattaattaaatcatctgacttggacaaat

actctgctgtggaactggtttacttagtaagctacatggagttccttgccgatttacaagctaccacctgcttctcagac

acactttctggtggcttgctaacaaagacccttgcaccggtgagggcttggatacaagagaaaaagatgcagctgtttgg

tcttgaggactacgcgaagttagtcaaagcagttgatttccacccggtggatttttctttcaaagtggaaacttgggact

tcagattccaccccttgcaagcgtggaaagccttccgaccaagggaagtgtcggatgtagaggaaatggaaagtttgttc

tcagatggggacctgcttgattgcttcacaagaatgccagcttatgcggtaaacgcagaggaagatttagctgcaatcag

gaaaacgcccgagatggatgtcggtcaagaagttaaagagcctgcaggagacagaaatcaatactcaaaccctgcagaaa

ctttcctcaacaagctccacaggaaacacagtagggaggtgaaacaccaggccgcaaagaaagctaaacgcctagctgaa

atccaggagtcaatgagagctgaaggtgatgccgaaccaaatgaaataagcgggacgatgggggcaatacccagcaacgc

cgaacttcctggcacgaatgatgccagacaagaactcacactcccaaccactaaacctgtccctgcaaggtgggaagatg

cttcattcacagattctagtgtggaagaggagcaggttaaactccttggaaaagaaaccgttgaaacagcgacgcaacaa

gtcatcgaaggacttccttggaaacactggattcctcaattaaatgctgttggattcaaggcgctggaaattcagaggga

taggagtggaacaatgatcatgcccatcacagaaatggtctccgggctggaaaaagaggacttccctgaaggaactccaa

aagagttggcacgagaattgttcgctatgaacagaagccctgccaccatccctttggacctgcttagagccagagactac

ggcagtgatgtaaagaacaagagaattggtgccatcacaaagacacaggcaacgagttggggcgaatacttgacaggaaa

gatagaaagcttaactgagaggaaagttgcgacttgtgtcattcatggagctggaggttctggaaaaagtcatgccatcc

agaaggcattgagagaaattggcaagggctcggacatcactgtagtcctgccgaccaatgaactgcggctagattggagt

aagaaagtgcctaacactgagccctatatgttcaagacctctgaaaaggcgttaattgggggaacaggcagcatagtcat

ctttgacgattactcaaaacttcctcccggttacatagaagccttagtctgtttctactctaaaatcaagctaatcattc

taacaggagatagcagacaaagcgtctaccatgaaactgctgaggacgcctccatcaggcatttgggaccagcaacagag

tacttctcaaaatactgccgatactatctcaatgccacacaccgcaacaagaaagatcttgcgaacatgcttggtgtcta

cagtgagagaacgggagtcaccgaaatcagcatgagcgccgagttcttagaaggaatcccaactttggtaccctcggatg

agaagagaaagctgtacatgggcaccgggaggaatgacacgttcacatacgctggatgccaggggctaactaagccgaag

gtacaaatagtgttggaccacaacacccaagtgtgtagcgcgaatgtgatgtacacggcactttctagagccaccgatag

gattcacttcgtgaacacaagtgcaaattcctctgccttctgggaaaagttggacagcaccccttacctcaagactttcc

tatcagtggtgagagaacaagcactcagggagtacgagccggcagaggcagagccaattcaagagcctgagccccagaca

cacatgtgtgtcgagaatgaggagtccgtgctagaagagtacaaagaggaactcttggaaaagtttgacagagagatcca

ctctgaatcccatggtcattcaaactgtgtccaaactgaagacacaaccattcagttgttttcgcatcaacaagcaaaag

atgagaccctcctctgggcgactatagatgcgcggctcaagaccagcaatcaagaaacaaacttccgagaattcctgagc

aagaaggacattggggacgttctgtttttaaactaccaaaaagctatgggtttacccaaagagcgtattcctttttccca

agaggtctgggaagcttgtgcccacgaagtacaaagcaagtacctcagcaagtcaaagtgcaacttgatcaatgggactg

tgagacagagcccagacttcgatgaaaataagattatggtattcctcaagtcgcagtgggtcacaaaggtggaaaaacta

ggtctacccaagattaagccaggtcaaaccatagcagccttttaccagcagactgtgatgctttttggaactatggctag

gtacatgcgatggttcagacaggctttccagccaaaagaagtcttcataaactgtgagaccacgccagatgacatgtctg

catgggccttgaacaactggaatttcagcagacctagcttggctaatgactacacagctttcgaccagtctcaggatgga

gccatgttgcaatttgaggtgctcaaagccaaacaccactgcataccagaggaaatcattcaggcatacatagatattaa

gactaatgcacagattttcctaggcacgttatcaattatgcgcctgactggtgaaggtcccacttttgatgcaaacactg

agtgcaacatagcttacacccatacaaagtttgacatcccagccggaactgctcaagtttatgcaggagacgactccgca

ctggactgtgttccagaagtgaagcatagtttccacaggcttgaggacaaattactcctaaagtcaaagcctgtaatcac

gcagcaaaagaagggcagttggcctgagttttgtggttggctgatcacaccaaaaggggtgatgaaagacccaattaagc

tccatgttagcttaaaattggctgaagctaagggtgaactcaagaaatgtcaagattcctatgaaattgatctgagttat

gcctatgaccacaaggactctctgcatgacttgttcgatgagaaacagtgtcaggcacacacactcacttgcagaacact

aatcaagtcagggagaggcactgtctcactttcccgcctcagaaactttctttaaccgttaagttaccttagagatttga

ataagatggatattctcatcagtagtttgaaaagtttaggttattctaggacttccaaatctttagattcaggacctttg

gtagtacatgcagtagccggagccggtaagtccacagccctaaggaagttgatcctcagacacccaacattcaccgtgca

tacactcggtgtccctgacaaggtgagtatcagaactagaggcatacagaagccaggacctattcctgagggcaacttcg

caatcctcgatgagtatactttggacaacaccacaaggaactctaaccaggcactttttgctgacccttatcaggcaccg

gagtttagcctagagccccacttctacttggaaacatcatttcgagttccgaggaaagtggcagatttgatagctggctg

tggcttcgatttcgagaccaactcaccggaagaagggcacttagagatcactggcatattcaaagggcccctactcggaa

aggtgatagccattgatgaggagtctgagacaacactgtccaggcatggtgttgagtttgttaagccctgccaagtgacg

ggacttgagttcaaagtagtcactattgtgtctgccgcaccaatagaggaaattggccagtccacagctttctacaacgc

tatcaccaggtcaaagggattgacatatgtccgcgcagggccataggctgaccgctccggtcaattctgaaaaagtgtac

atagtattaggtctatcatttgctttagtttcaattacctttctgctttctagaaatagcttaccccacgtcggtgacaa

cattcacagcttgccacacggaggagcttacagagacggcaccaaagcaatcttgtacaactccccaaatctagggtcac

gagtgagtctacacaacggaaagaacgcagcatttgctgccgttttgctactgactttgctgatctatggaagtaaatac

atatctcaacgcaatcatacttgtgcttgtggtaacaatcatagcagtcattagcacttccttagtgaggactgaacctt

gtgtcatcaagattactggggaatcaatcacagtgttggcttgcaaactagatgcagaaaccataagggccattgccgat

ctcaagccactctccgttgaacggttaagtttccattgatactcgaaagaGGTCAGCACCAGCTAGCATCGATCGCGATA

TCGTCGACCGCCGATgaacggttaagtttccattgatactcgaaagatgtcagcaccagctagcacaacacagcccatag

ggtcaactacctcaactaccacaaaaactgcaggcgcaactcctgccacagcttcaggcctgttcaccatcccggatggg

gatttctttagtacagcccgtgccatagtagccagcaatgctgtcgcaacaaatgaggacctcagcaagattgaggctat

ttggaaggacatgaaggtgcccacagacactatggcacaggctgcttgggacttagtcagacactgtgctgatgtaggat

catccgctcaaacagaaatgatagatacaggtccctattccaacggcatcagcagagctagactggcagcagcaattaaa

gaggtgtgcacacttaggcaattttgcatgaagtatgctccagtggtatggaactggatgttaactaacaacagtccacc

tgctaactggcaagcacaaggtttcaagcctgagcacaaattcgctgcattcgacttcttcaatggagtcaccaacccag

ctgccatcatgcccaaagaggggctcatccggccaccgtctgaagctgaaatgaatgctgcccaaactgctgcctttgtg

aagattacaaaggccagggcacaatccaacgactttgccagcctagatgcagctgtcaCTCGAGGTCGTATCACTGGAAC

AACAACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTCTACATAACCGACGCCTACCCCAGTTTCATAGTA

TTTTCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAAAAAAAAAAACTAGTggtACCGAGCTCggtaccc

catgcaagcttttgttccctttagtgagggttaattccgagcttggcgtaatcatggtcatagctgtttcctgtgtgaaa

ttgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagct

aactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggc

caacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcg

gctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaaca

tgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccct

gacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccc

tggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcg

tggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaa

ccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcc

actggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggccta

actacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagc

tcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagg

atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca

tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgag

taaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagt

tgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgag

acccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaact

ttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgt

tgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaa

ggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttg

gccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt

gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacggg

ataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatc

ttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgt

ttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatac

tcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaa

aataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacatt

aacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgc

agctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgtt

ggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaatacc

gcacagatgcgtaaggagaaaataccgcatcaggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttg

ttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggt

tgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctat

cagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaa

ccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaag

gagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgcta

cagggcgcgtcgcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacg

ccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaa

cgacggccagtgaattgtaatacgactcactata

from DNA Strider Wednesday, August 31, 1994 14:27:32; DNA sequence TXGC3S.VEC 11655 b.p. complete sequence;

GAAAACTAAACCATACACCACCAACACAACCAAACCCACCACGCCCAATTGTTACACACCCGCTTGAAAAAGAAAGTTTA

ACAAATGGCCAAGGTGCGCGAGGTTTACCAATCTTTTACAGACTCCACCACAAAAACTCTCATCCAAGATGAGGCTTATA

GAAACATTCGCCCCATCATGGAAAAACACAAACTAGCTAACCCTTACGCTCAAACGGTTGAAGCGGCTAATGATCTAGAG

GGGTTCGGCATAGCCACCAATCCCTATAGCATTGAATTGCATACACATGCAGCCGCTAAGACCATAGAGAATAAACTTCT

AGAGGTGCTTGGTTCCATCCTACCACAAGAACCTGTTACATTTATGTTTCTTAAACCCAGAAAGCTAAACTACATGAGAA

GAAACCCGCGGATCAAGGACATTTTCCAAAATGTTGCCATTGAACCAAGAGACGTAGCCAGGTACCCCAAGGAAACAATA

ATTGACAAACTCACAGAGATCACAACGGAAACAGCATACATTAGTGACACTCTGCACTTCTTGGATCCGAGCTACATAGT

GGAGACATTCCAAAACTGCCCAAAATTGCAAACATTGTATGCGACCTTAGTTCTCCCCGTTGAGGCAGCCTTTAAAATGG

AAAGCACTCACCCGAACATATACAGCCTCAAATACTTCGGAGATGGTTTCCAGTATATACCAGGCAACCATGGTGGCGGG

GCATACCATCATGAATTCGCTCATCTACAATGGCTCAAAGTGGGAAAGATCAAGTGGAGGGACCCCAAGGATAGCTTTCT

CGGACATCTCAATTACACGACTGAGCAGGTTGAGATGCACACAGTGACAGTACAGTTGCAGGAATCGTTCGCGGCAAACC

ACTTGTACTGCATCAGGAGAGGAGACTTGCTCACACCGGAGGTGCGCACTTTCGGCCAACCTGACAGGTACGTGATTCCA

CCACAGATCTTCCTCCCAAAAGTTCACAACTGCAAGAAGCCGATTCTCAAGAAAACTATGATGCAGCTCTTCTTGTATGT

TAGGACAGTCAAGGTCGCAAAAAATTGTGACATTTTTGCCAAAGTCAGACAATTAATTAAATCATCTGACTTGGACAAAT

ACTCTGCTGTGGAACTGGTTTACTTAGTAAGCTACATGGAGTTCCTTGCCGATTTACAAGCTACCACCTGCTTCTCAGAC

ACACTTTCTGGTGGCTTGCTAACAAAGACCCTTGCACCGGTGAGGGCTTGGATACAAGAGAAAAAGATGCAGCTGTTTGG

TCTTGAGGACTACGCGAAGTTAGTCAAAGCAGTTGATTTCCACCCGGTGGATTTTTCTTTCAAAGTGGAAACTTGGGACT

TCAGATTCCACCCCTTGCAAGCGTGGAAAGCCTTCCGACCAAGGGAAGTGTCGGATGTAGAGGAAATGGAAAGTTTGTTC

TCAGATGGGGACCTGCTTGATTGCTTCACAAGAATGCCAGCTTATGCGGTAAACGCAGAGGAAGATTTAGCTGCAATCAG

GAAAACGCCCGAGATGGATGTCGGTCAAGAAGTTAAAGAGCCTGCAGgagacagaaatcaatactcaaaccCTGCAGAAA

CTTTCCTCAACAAGCTCCACAGGAAACACAGTAGGGAGGTGAAACACCAGGCCGCAAAGAAAGCTAAACGCCTAGCTGAA

ATCCAGGAGTCAATGAGAGCTGAAGGTGATGCCGAACCAAATGAAATAAGCGGGacgaTGGGGGCAATACCCAGCAACGC

CGAACTTCCTGGCACGAATGATGCCAGACAAGAACTCACACTCCCAACCACTAAACCTGTCCCTGCAAGGTGGGAAGATG

CTTCATTCACAGATTCTAGTGTGGAAGAGGAGCAGGTTAAACTCCTTGGAAAAGAAACCGTTGAAACAGCGACGCAACAA

GTCATCGAAGGACTTCCTTGGAAACACTGGATTCCTCAATTAAATGCTGTTGGATTCAAGGCGCTGGAAATTCAGAGGGA

TAGGAGTGGAACAATGATCATGCCCATCACAGAAATGGTCTCCGGGCTGGAAAAAGAGGACTTCCCTGAAGGAACTCCAA

AAGAGTTGGCACGAGAATTGTTCGCTATGAACAGAAGCCCTGCCACCATCCCTTTGGACCTGCTTAGAGCCAGAGACTAC

GGCAGTGATGTAAAGAACAAGAGAATTGGTGCCATCACAAAGACACAGGCAACGAGTTGGGGCGAATACTTGACAGGAAA

GATAGAAAGCTTAACTGAGAGGAAAGTTGCGACTTGTGTCATTCATGGAGCTGGAGGTTCTGGAAAAAGTCATGCCATCC

AGAAGGCATTGAGAGAAATTGGCAAGGGCTCGGACATCACTGTAGTCCTGCCGACCAATGAACTGCGGCTAGATTGGAGT

AAGAAAGTGCCTAACACTGAGCCCTATATGTTCAAGACCTCTGAAAAGGCGTTAATTGGGGGAACAGGCAGCATAGTCAT

CTTTGACGATTACTCAAAACTTCCTCCCGGTTACATAGAAGCCTTAGTCTGTTTCTACTCTAAAATCAAGCTAATCATTC

TAACAGGAGATAGCAGACAAAGCGTCTACCATGAAACTGCTGAGGACGCCTCCATCAGGCATTTGGGACCAGCAACAGAG

TACTTCTCAAAATACTGCCGATACTATCTCAATGCCACACACCGCAACAAGAAAGATCTTGCGAACATGCTTGGTGTCTA

CAGTGAGAGAACGGGAGTCACCGAAATCAGCATGAGCGCCGAGTTCTTAGAAGGAATCCCAACTTTGGTACCCTCGGATG

AGAAGAGAAAGCTGTACATGGGCACCGGGAGGAATGACACGTTCACATACGCTGGATGCCAGGGGCTAACTAAGCCGAAG

GTACAAATAGTGTTGGACCACAACACCCAAGTGTGTAGCGCGAATGTGATGTACACGGCACTTTCTAGAGCCACCGATAG

GATTCACTTCGTGAACACAAGTGCAAATTCCTCTGCCTTCTGGGAAAAGTTGGACAGCACCCCTTACCTCAAGACTTTCC

TATCAGTGGTGAGAGAACAAGCACTCAGGGAGTACGAGCCGGCAGAGGCAGAGCCAATTCAAGAGCCTGAGCCCCAGACA

CACATGTGTGTCGAGAATGAGGAGTCCGTGCTAGAAGAGTACAAAGAGGAACTCTTGGAAAAGTTTGACAGAGAGATCCA

CTCTGAATCCCATGGTCATTCAAACTGTGTCCAAACTGAAGACACAACCATTCAGTTGTTTTCGCATCAACAAGCAAAAG

ATGAGACCCTCCTCTGGGCGACTATAGATGCGCGGCTCAAGACCAGCAATCAAGAAACAAACTTCCGAGAATTCCTGAGC

AAGAAGGACATTGGGGACGTTCTGTTTTTAAACTACCAAAAAGCTATGGGTTTACCCAAAGAGCGTATTCCTTTTTCCCA

AGAGGTCTGGGAAGCTTGTGCCCACGAAGTACAAAGCAAGTACCTCAGCAAGTCAAAGTGCAACTTGATCAATGGGACTG

TGAGACAGAGCCCAGACTTCGATGAAAATAAGATTATGGTATTCCTCAAGTCGCAGTGGGTCACAAAGGTGGAAAAACTA

GGTCTACCCAAGATTAAGCCAGGTCAAACCATAGCAGCCTTTTACCAGCAGACTGTGATGCTTTTTGGAACTATGGCTAG

GTACATGCGATGGTTCAGACAGGCTTTCCAGCCAAAAGAAGTCTTCATAAACTGTGAGACCACGCCAGATGACATGTCTG

CATGGGCCTTGAACAACTGGAATTTCAGCAGACCTAGCTTGGCTAATGACTACACAGCTTTCGACCAGTCTCAGGATGGA

GCCATGTTGCAATTTGAGGTGCTCAAAGCCAAACACCACTGCATACCAGAGGAAATCATTCAGGCATACATAGATATTAA

GACTAATGCACAGATTTTCCTAGGCACGTTATCAATTATGCGCCTGACTGGTGAAGGTCCCACTTTTGATGCAAACACTG

AGTGCAACATAGCTTACACCCATACAAAGTTTGACATCCCAGCCGGAACTGCTCAAGTTTATGCAGGAGACGACTCCGCA

CTGGACTGTGTTCCAGAAGTGAAGCATAGTTTCCACAGGCTTGAGGACAAATTACTCCTAAAGTCAAAGCCTGTAATCAC

GCAGCAAAAGAAGGGCAGTTGGCCTGAGTTTTGTGGTTGGCTGATCACACCAAAAGGGGTGATGAAAGACCCAATTAAGC

TCCATGTTAGCTTAAAATTGGCTGAAGCTAAGGGTGAACTCAAGAAATGTCAAGATTCCTATGAAATTGATCTGAGTTAT

GCCTATGACCACAAGGACTCTCTGCATGACTTGTTCGATGAGAAACAGTGTCAGGCACACACACTCACTTGCAGAACACT

AATCAAGTCAGGGAGAGGCACTGTCTCACTTTCCCGCCTCAGAAACTTTCTTTAACCGTTAAGTTACCTTAGAGATTTGA

ATAAGATGGATATTCTCATCAGTAGTTTGAAAAGTTTAGGTTATTCTAGGACTTCCAAATCTTTAGATTCAGGACCTTTG

GTAGTACATGCAGTAGCCGGAGCCGGTAAGTCCACAGCCCTAAGGAAGTTGATCCTCAGACACCCAACATTCACCGTGCA

TACACTCGGTGTCCCTGACAAGGTGAGTATCAGAACTAGAGGCATACAGAAGCCAGGACCTATTCCTGAGGGCAACTTCG

CAATCCTCGATGAGTATACTTTGGACAACACCACAAGGAACTCTAACCAGGCACTTTTTGCTGACCCTTATCAGGCACCG

GAGTTTAGCCTAGAGCCCCACTTCTACTTGGAAACATCATTTCGAGTTCCGAGGAAAGTGGCAGATTTGATAGCTGGCTG

TGGCTTCGATTTCGAGACCAACTCACCGGAAGAAGGGCACTTAGAGATCACTGGCATATTCAAAGGGCCCCTACTCGGAA

AGGTGATAGCCATTGATGAGGAGTCTGAGACAACACTGTCCAGGCATGGTGTTGAGTTTGTTAAGCCCTGCCAAGTGACG

GGACTTGAGTTCAAAGTAGTCACTATTGTGTCTGCCGCACCAATAGAGGAAATTGGCCAGTCCACAGCTTTCTACAACGC

TATCACCAGGTCAAAGGGATTGACATATGTCCGCGCAGGGCCATAGGCTGACCGCTCCGGTCAATTCTGAAAAAGTGTAC

ATAGTATTAGGTCTATCATTTGCTTTAGTTTCAATTACCTTTCTGCTTTCTAGAAATAGCTTACCCCACGTCGGTGACAA

CATTCACAGCTTGCCACACGGAGGAGCTTACAGAGACGGCACCAAAGCAATCTTGTACAACTCCCCAAATCTAGGGTCAC

GAGTGAGTCTACACAACGGAAAGAACGCAGCATTTGCTGCCGTTTTGCTACTGACTTTGCTGATCTATGGAAGTAAATAC

ATATCTCAACGCAATCATACTTGTGCTTGTGGTAACAATCATAGCAGTCATTAGCACTTCCTTAGTGAGGACTGAACCTT

GTGTCATCAAGATTACTGGGGAATCAATCACAGTGTTGGCTTGCAAACTAGATGCAGAAACCATAAGGGCCATTGCCGAT

CTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGCTAGAGGATCCCCGGGTG

GTCAGTCCCTTATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTG

GATCGCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGCTGTGCCAGGCAG

TTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAAGTCTTTATACCGA

AAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAAAGTGTGGGTCAATAATCAGGAA

GTGATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTAT

CACCGTTTGTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGAAAACGGCAAGAAAA

AGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGCCGAACACCTGG

GTGGACGATATCACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCGTCTGTTGACTGGCAGGTGGTGGCCAATGG

TGATGTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGACTTTGCAAGTGG

TGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGTGCGTCACAGCCAAAAGCCAGACAGAGTGTGAT

ATCTACCCGCTTCGCGTCGGCATCCGGTCAGTGGCAGTGAAGGGCCAACAGTTCCTGATTAACCACAAACCGTTCTACTT

TACTGGCTTTGGTCGTCATGAAGATGCGGACTTACGTGGCAAAGGATTCGATAACGTGCTGATGGTGCACGACCACGCAT

TAATGGACTGGATTGGGGCCAACTCCTACCGTACCTCGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAA

CATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTCGAAGCGGGCAACAA

GCCGAAAGAACTGTACAGCGAAGAGGCAGTCAACGGGGAAACTCAGCAAGCGCACTTACAGGCGATTAAAGAGCTGATAG

CGCGTGACAAAAACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACGAACCGGATACCCGTCCGCAAGTGCACGGGAAT

ATTTCGCCACTGGCGGAAGCAACGCGTAAACTCGACCCGACGCGTCCGATCACCTGCGTCAATGTAATGTTCTGCGACGC

TCACACCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCGTTATTACGGATGGTATGTCCAAAGCGGCGATT

TGGAAACGGCAGAGAAGGTACTGGAAAAAGAACTTCTGGCCTGGCAGGAGAAACTGCATCAGCCGATTATCATCACCGAA

TACGGCGTGGATACGTTAGCCGGGCTGCACTCAATGTACACCGACATGTGGAGTGAAGAGTATCAGTGTGCATGGCTGGA

TATGTATCACCGCGTCTTTGATCGCGTCAGCGCCGTCGTCGGTGAACAGGTATGGAATTTCGCCGATTTTGCGACCTCGC

AAGGCATATTGCGCGTTGGCGGTAACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGCGGCTTTTCTGCTG

CAAAAACGCTGGACTGGCATGAACTTCGGTGAAAAACCGCAGCAGGGAGGCAAACAATGAATCAACAACTCTCCTGGCGC

ACCATCGTCGGCTACAGCCTCGGGAATTGCTACCGATCAAGCTTATCGATAAGCTTGATAGGGCCATTGCCGATCTCAAG

CCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGCTAGCACAACACAGCCCATAGGGT

CAACTACCTCAACTACCACAAAAACTGCAGGCGCAACTCCTGCCACAGCTTCAGGCCTGTTCACCATCCCGGATGGGGAT

TTCTTTAGTACAGCCCGTGCCATAGTAGCCAGCAATGCTGTCGCAACAAATGAGGACCTCAGCAAGATTGAGGCTATTTG

GAAGGACATGAAGGTGCCCACAGACACTATGGCACAGGCTGCTTGGGACTTAGTCAGACACTGTGCTGATGTAGGATCAT

CCGCTCAAACAGAAATGATAGATACAGGTCCCTATTCCAACGGCATCAGCAGAGCTAGACTGGCAGCAGCAATTAAAGAG

GTGTGCACACTTAGGCAATTTTGCATGAAGTATGCTCCAGTGGTATGGAACTGGATGTTAACTAACAACaGTCCACCTGC

TAACTGGCAAGCACAAGGTTTCAAGCCTGAGCACAAATTCGCTGCATTCGACTTCTTCAATGGAGTCACCAACCCAGCTG

CCATCATGCCCAAAGAGGGGCTCATCCGGCCACCGTCTGAAGCTGAAATGAATGCTGCCCAAACTGCTGCCTTTGTGAAG

ATTACAAAGGCCAGGGCACAATCCAACGACTTTGCCAGCCTAGATGCAGCTGTCACTCGAGGTCGTATCACTGGAACAAC

AACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTCTACATAACCGACGCCTACCCCAGTTTCATAGTATTT

TCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAAAAAAAAAAACTAGTACCGAGCTCGGTACCCGGGGAT

CCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGTTCCCTTTAGTGAGGGTTAATTCCGAGCTTGGCGTAATCATGGTC

ATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCT

GGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGC

CAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGA

CTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAG

GGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTT

TTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATA

AAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCG

CCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCC

AAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCC

GGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAG

AGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACC

TTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA

GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACT

CACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAA

TCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTG

TCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCA

GTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAG

CGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCC

AGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCA

GCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCG

ATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCC

ATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCT

CTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCG

GGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGC

ATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACAC

GGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC

ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGA

AACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACG

GTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGT

CAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCA

CCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAACGTTAATATTTTGTT

AAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAA

AAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTC

AAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTG

CCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAA

AGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCC

GCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGT

GCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTT

CCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATA

from DNA Strider Tuesday, October 3, 1995 9:10:12 am; DNA sequence pTXS-GFP 10491 b.p. complete sequence;

GAAAACTAAACCATACACCACCAACACAACCAAACCCACCACGCCCAATTGTTACACACCCGCTTGAAAAAGAAAGTTTA

ACAAATGGCCAAGGTGCGCGAGGTTTACCAATCTTTTACAGACTCCACCACAAAAACTCTCATCCAAGATGAGGCTTATA

GAAACATTCGCCCCATCATGGAAAAACACAAACTAGCTAACCCTTACGCTCAAACGGTTGAAGCGGCTAATGATCTAGAG

GGGTTCGGCATAGCCACCAATCCCTATAGCATTGAATTGCATACACATGCAGCCGCTAAGACCATAGAGAATAAACTTCT

AGAGGTGCTTGGTTCCATCCTACCACAAGAACCTGTTACATTTATGTTTCTTAAACCCAGAAAGCTAAACTACATGAGAA

GAAACCCGCGGATCAAGGACATTTTCCAAAATGTTGCCATTGAACCAAGAGACGTAGCCAGGTACCCCAAGGAAACAATA

ATTGACAAACTCACAGAGATCACAACGGAAACAGCATACATTAGTGACACTCTGCACTTCTTGGATCCGAGCTACATAGT

GGAGACATTCCAAAACTGCCCAAAATTGCAAACATTGTATGCGACCTTAGTTCTCCCCGTTGAGGCAGCCTTTAAAATGG

AAAGCACTCACCCGAACATATACAGCCTCAAATACTTCGGAGATGGTTTCCAGTATATACCAGGCAACCATGGTGGCGGG

GCATACCATCATGAATTCGCTCATCTACAATGGCTCAAAGTGGGAAAGATCAAGTGGAGGGACCCCAAGGATAGCTTTCT

CGGACATCTCAATTACACGACTGAGCAGGTTGAGATGCACACAGTGACAGTACAGTTGCAGGAATCGTTCGCGGCAAACC

ACTTGTACTGCATCAGGAGAGGAGACTTGCTCACACCGGAGGTGCGCACTTTCGGCCAACCTGACAGGTACGTGATTCCA

CCACAGATCTTCCTCCCAAAAGTTCACAACTGCAAGAAGCCGATTCTCAAGAAAACTATGATGCAGCTCTTCTTGTATGT

TAGGACAGTCAAGGTCGCAAAAAATTGTGACATTTTTGCCAAAGTCAGACAATTAATTAAATCATCTGACTTGGACAAAT

ACTCTGCTGTGGAACTGGTTTACTTAGTAAGCTACATGGAGTTCCTTGCCGATTTACAAGCTACCACCTGCTTCTCAGAC

ACACTTTCTGGTGGCTTGCTAACAAAGACCCTTGCACCGGTGAGGGCTTGGATACAAGAGAAAAAGATGCAGCTGTTTGG

TCTTGAGGACTACGCGAAGTTAGTCAAAGCAGTTGATTTCCACCCGGTGGATTTTTCTTTCAAAGTGGAAACTTGGGACT

TCAGATTCCACCCCTTGCAAGCGTGGAAAGCCTTCCGACCAAGGGAAGTGTCGGATGTAGAGGAAATGGAAAGTTTGTTC

TCAGATGGGGACCTGCTTGATTGCTTCACAAGAATGCCAGCTTATGCGGTAAACGCAGAGGAAGATTTAGCTGCAATCAG

GAAAACGCCCGAGATGGATGTCGGTCAAGAAGTTAAAGAGCCTGCAGGAGACAGAAATCAATACTCAAACCCTGCAGAAA

CTTTCCTCAACAAGCTCCACAGGAAACACAGTAGGGAGGTGAAACACCAGGCCGCAAAGAAAGCTAAACGCCTAGCTGAA

ATCCAGGAGTCAATGAGAGCTGAAGGTGATGCCGAACCAAATGAAATAAGCGGGACGATGGGGGCAATACCCAGCAACGC

CGAACTTCCTGGCACGAATGATGCCAGACAAGAACTCACACTCCCAACCACTAAACCTGTCCCTGCAAGGTGGGAAGATG

CTTCATTCACAGATTCTAGTGTGGAAGAGGAGCAGGTTAAACTCCTTGGAAAAGAAACCGTTGAAACAGCGACGCAACAA

GTCATCGAAGGACTTCCTTGGAAACACTGGATTCCTCAATTAAATGCTGTTGGATTCAAGGCGCTGGAAATTCAGAGGGA

TAGGAGTGGAACAATGATCATGCCCATCACAGAAATGGTCTCCGGGCTGGAAAAAGAGGACTTCCCTGAAGGAACTCCAA

AAGAGTTGGCACGAGAATTGTTCGCTATGAACAGAAGCCCTGCCACCATCCCTTTGGACCTGCTTAGAGCCAGAGACTAC

GGCAGTGATGTAAAGAACAAGAGAATTGGTGCCATCACAAAGACACAGGCAACGAGTTGGGGCGAATACTTGACAGGAAA

GATAGAAAGCTTAACTGAGAGGAAAGTTGCGACTTGTGTCATTCATGGAGCTGGAGGTTCTGGAAAAAGTCATGCCATCC

AGAAGGCATTGAGAGAAATTGGCAAGGGCTCGGACATCACTGTAGTCCTGCCGACCAATGAACTGCGGCTAGATTGGAGT

AAGAAAGTGCCTAACACTGAGCCCTATATGTTCAAGACCTCTGAAAAGGCGTTAATTGGGGGAACAGGCAGCATAGTCAT

CTTTGACGATTACTCAAAACTTCCTCCCGGTTACATAGAAGCCTTAGTCTGTTTCTACTCTAAAATCAAGCTAATCATTC

TAACAGGAGATAGCAGACAAAGCGTCTACCATGAAACTGCTGAGGACGCCTCCATCAGGCATTTGGGACCAGCAACAGAG

TACTTCTCAAAATACTGCCGATACTATCTCAATGCCACACACCGCAACAAGAAAGATCTTGCGAACATGCTTGGTGTCTA

CAGTGAGAGAACGGGAGTCACCGAAATCAGCATGAGCGCCGAGTTCTTAGAAGGAATCCCAACTTTGGTACCCTCGGATG

AGAAGAGAAAGCTGTACATGGGCACCGGGAGGAATGACACGTTCACATACGCTGGATGCCAGGGGCTAACTAAGCCGAAG

GTACAAATAGTGTTGGACCACAACACCCAAGTGTGTAGCGCGAATGTGATGTACACGGCACTTTCTAGAGCCACCGATAG

GATTCACTTCGTGAACACAAGTGCAAATTCCTCTGCCTTCTGGGAAAAGTTGGACAGCACCCCTTACCTCAAGACTTTCC

TATCAGTGGTGAGAGAACAAGCACTCAGGGAGTACGAGCCGGCAGAGGCAGAGCCAATTCAAGAGCCTGAGCCCCAGACA

CACATGTGTGTCGAGAATGAGGAGTCCGTGCTAGAAGAGTACAAAGAGGAACTCTTGGAAAAGTTTGACAGAGAGATCCA

CTCTGAATCCCATGGTCATTCAAACTGTGTCCAAACTGAAGACACAACCATTCAGTTGTTTTCGCATCAACAAGCAAAAG

ATGAGACCCTCCTCTGGGCGACTATAGATGCGCGGCTCAAGACCAGCAATCAAGAAACAAACTTCCGAGAATTCCTGAGC

AAGAAGGACATTGGGGACGTTCTGTTTTTAAACTACCAAAAAGCTATGGGTTTACCCAAAGAGCGTATTCCTTTTTCCCA

AGAGGTCTGGGAAGCTTGTGCCCACGAAGTACAAAGCAAGTACCTCAGCAAGTCAAAGTGCAACTTGATCAATGGGACTG

TGAGACAGAGCCCAGACTTCGATGAAAATAAGATTATGGTATTCCTCAAGTCGCAGTGGGTCACAAAGGTGGAAAAACTA

GGTCTACCCAAGATTAAGCCAGGTCAAACCATAGCAGCCTTTTACCAGCAGACTGTGATGCTTTTTGGAACTATGGCTAG

GTACATGCGATGGTTCAGACAGGCTTTCCAGCCAAAAGAAGTCTTCATAAACTGTGAGACCACGCCAGATGACATGTCTG

CATGGGCCTTGAACAACTGGAATTTCAGCAGACCTAGCTTGGCTAATGACTACACAGCTTTCGACCAGTCTCAGGATGGA

GCCATGTTGCAATTTGAGGTGCTCAAAGCCAAACACCACTGCATACCAGAGGAAATCATTCAGGCATACATAGATATTAA

GACTAATGCACAGATTTTCCTAGGCACGTTATCAATTATGCGCCTGACTGGTGAAGGTCCCACTTTTGATGCAAACACTG

AGTGCAACATAGCTTACACCCATACAAAGTTTGACATCCCAGCCGGAACTGCTCAAGTTTATGCAGGAGACGACTCCGCA

CTGGACTGTGTTCCAGAAGTGAAGCATAGTTTCCACAGGCTTGAGGACAAATTACTCCTAAAGTCAAAGCCTGTAATCAC

GCAGCAAAAGAAGGGCAGTTGGCCTGAGTTTTGTGGTTGGCTGATCACACCAAAAGGGGTGATGAAAGACCCAATTAAGC

TCCATGTTAGCTTAAAATTGGCTGAAGCTAAGGGTGAACTCAAGAAATGTCAAGATTCCTATGAAATTGATCTGAGTTAT

GCCTATGACCACAAGGACTCTCTGCATGACTTGTTCGATGAGAAACAGTGTCAGGCACACACACTCACTTGCAGAACACT

AATCAAGTCAGGGAGAGGCACTGTCTCACTTTCCCGCCTCAGAAACTTTCTTTAACCGTTAAGTTACCTTAGAGATTTGA

ATAAGATGGATATTCTCATCAGTAGTTTGAAAAGTTTAGGTTATTCTAGGACTTCCAAATCTTTAGATTCAGGACCTTTG

GTAGTACATGCAGTAGCCGGAGCCGGTAAGTCCACAGCCCTAAGGAAGTTGATCCTCAGACACCCAACATTCACCGTGCA

TACACTCGGTGTCCCTGACAAGGTGAGTATCAGAACTAGAGGCATACAGAAGCCAGGACCTATTCCTGAGGGCAACTTCG

CAATCCTCGATGAGTATACTTTGGACAACACCACAAGGAACTCTAACCAGGCACTTTTTGCTGACCCTTATCAGGCACCG

GAGTTTAGCCTAGAGCCCCACTTCTACTTGGAAACATCATTTCGAGTTCCGAGGAAAGTGGCAGATTTGATAGCTGGCTG

TGGCTTCGATTTCGAGACCAACTCACCGGAAGAAGGGCACTTAGAGATCACTGGCATATTCAAAGGGCCCCTACTCGGAA

AGGTGATAGCCATTGATGAGGAGTCTGAGACAACACTGTCCAGGCATGGTGTTGAGTTTGTTAAGCCCTGCCAAGTGACG

GGACTTGAGTTCAAAGTAGTCACTATTGTGTCTGCCGCACCAATAGAGGAAATTGGCCAGTCCACAGCTTTCTACAACGC

TATCACCAGGTCAAAGGGATTGACATATGTCCGCGCAGGGCCATAGGCTGACCGCTCCGGTCAATTCTGAAAAAGTGTAC

ATAGTATTAGGTCTATCATTTGCTTTAGTTTCAATTACCTTTCTGCTTTCTAGAAATAGCTTACCCCACGTCGGTGACAA

CATTCACAGCTTGCCACACGGAGGAGCTTACAGAGACGGCACCAAAGCAATCTTGTACAACTCCCCAAATCTAGGGTCAC

GAGTGAGTCTACACAACGGAAAGAACGCAGCATTTGCTGCCGTTTTGCTACTGACTTTGCTGATCTATGGAAGTAAATAC

ATATCTCAACGCAATCATACTTGTGCTTGTGGTAACAATCATAGCAGTCATTAGCACTTCCTTAGTGAGGACTGAACCTT

GTGTCATCAAGATTACTGGGGAATCAATCACAGTGTTGGCTTGCAAACTAGATGCAGAAACCATAAGGGCCATTGCCGAT

CTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGAGGTCAGCACCAGCTAGCatcgatCatgagt

aaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgt

cagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttc

catggccaacacttgtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacagcatgac

tttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacg

tgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaaca

ttcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaa

gttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattgg

cgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagag

accacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataaatgtcgacC

GCCGATAAGCTTGATAGGGCCATTGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGA

TGTCAGCACCAGCTAGCACAACACAGCCCATAGGGTCAACTACCTCAACTACCACAAAAACTGCAGGCGCAACTCCTGCC

ACAGCTTCAGGCCTGTTCACCATCCCGGATGGGGATTTCTTTAGTACAGCCCGTGCCATAGTAGCCAGCAATGCTGTCGC

AACAAATGAGGACCTCAGCAAGATTGAGGCTATTTGGAAGGACATGAAGGTGCCCACAGACACTATGGCACAGGCTGCTT

GGGACTTAGTCAGACACTGTGCTGATGTAGGATCATCCGCTCAAACAGAAATGATAGATACAGGTCCCTATTCCAACGGC

ATCAGCAGAGCTAGACTGGCAGCAGCAATTAAAGAGGTGTGCACACTTAGGCAATTTTGCATGAAGTATGCTCCAGTGGT

ATGGAACTGGATGTTAACTAACAACAGTCCACCTGCTAACTGGCAAGCACAAGGTTTCAAGCCTGAGCACAAATTCGCTG

CATTCGACTTCTTCAATGGAGTCACCAACCCAGCTGCCATCATGCCCAAAGAGGGGCTCATCCGGCCACCGTCTGAAGCT

GAAATGAATGCTGCCCAAACTGCTGCCTTTGTGAAGATTACAAAGGCCAGGGCACAATCCAACGACTTTGCCAGCCTAGA

TGCAGCTGTCACTCGAGGTCGTATCACTGGAACAACAACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTC

TACATAACCGACGCCTACCCCAGTTTCATAGTATTTTCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAA

AAAAAAAAACTAGTACCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGTTCCCTTTA

GTGAGGGTTAATTCCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCAC

ACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGC

TCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTT

GCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC

ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAG

GCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACG

CTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTC

CTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGC

TGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTG

CGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACA

GGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACA

GTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCAC

CGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCT

TTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTC

ACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCA

ATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGA

TAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGAT

TTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTAT

TAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCG

TGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATG

TTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGT

TATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGT

CATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGA

ACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTC

GATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAA

GGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGA

AGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG

CACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCA

CGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCT

TGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAA

CTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAAT

ACCGCATCAGGAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACC

AATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAAC

AAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGA

ACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTA

GAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCA

AGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCGCC

ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTG

CTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATAC

GACTCACTATA

pPVX201-please use this as a working guide

gaaaactaaaccatacaccaccaacacaaccaaacccaccacgcccaattgttacacacccgcttgaaaaagaaagttta

acaaatggccaaggtgcgcgaggtttaccaatcttttacagactccaccacaaaaactctcatccaagatgaggcttata

gaaacattcgccccatcatggaaaaacacaaactagctaacccttacgctcaaacggttgaagcggctaatgatctagag

gggttcggcatagccaccaatccctatagcattgaattgcatacacatgcagccgctaagaccatagagaataaacttct

agaggtgcttggttccatcctaccacaagaacctgttacatttatgtttcttaaacccagaaagctaaactacatgagaa

gaaacccgcggatcaaggacattttccaaaatgttgccattgaaccaagagacgtagccaggtaccccaaggaaacaata

attgacaaactcacagagatcacaacggaaacagcatacattagtgacactctgcacttcttggatccgagctacatagt

ggagacattccaaaactgcccaaaattgcaaacattgtatgcgaccttagttctccccgttgaggcagcctttaaaatgg

aaagcactcacccgaacatatacagcctcaaatacttcggagatggtttccagtatataccaggcaaccatggtggcggg

gcataccatcatgaattcgctcatctacaatggctcaaagtgggaaagatcaagtggagggaccccaaggatagctttct

cggacatctcaattacacgactgagcaggttgagatgcacacagtgacagtacagttgcaggaatcgttcgcggcaaacc

acttgtactgcatcaggagaggagacttgctcacaccggaggtgcgcactttcggccaacctgacaggtacgtgattcca

ccacagatcttcctcccaaaagttcacaactgcaagaagccgattctcaagaaaactatgatgcagctcttcttgtatgt

taggacagtcaaggtcgcaaaaaattgtgacatttttgccaaagtcagacaattaattaaatcatctgacttggacaaat

actctgctgtggaactggtttacttagtaagctacatggagttccttgccgatttacaagctaccacctgcttctcagac

acactttctggtggcttgctaacaaagacccttgcaccggtgagggcttggatacaagagaaaaagatgcagctgtttgg

tcttgaggactacgcgaagttagtcaaagcagttgatttccacccggtggatttttctttcaaagtggaaacttgggact

tcagattccaccccttgcaagcgtggaaagccttccgaccaagggaagtgtcggatgtagaggaaatggaaagtttgttc

tcagatggggacctgcttgattgcttcacaagaatgccagcttatgcggtaaacgcagaggaagatttagctgcaatcag

gaaaacgcccgagatggatgtcggtcaagaagttaaagagcctgcaggagacagaaatcaatactcaaaccctgcagaaa

ctttcctcaacaagctccacaggaaacacagtagggaggtgaaacaccaggccgcaaagaaagctaaacgcctagctgaa

atccaggagtcaatgagagctgaaggtgatgccgaaccaaatgaaataagcgggacgatgggggcaatacccagcaacgc

cgaacttcctggcacgaatgatgccagacaagaactcacactcccaaccactaaacctgtccctgcaaggtgggaagatg

cttcattcacagattctagtgtggaagaggagcaggttaaactccttggaaaagaaaccgttgaaacagcgacgcaacaa

gtcatcgaaggacttccttggaaacactggattcctcaattaaatgctgttggattcaaggcgctggaaattcagaggga

taggagtggaacaatgatcatgcccatcacagaaatggtctccgggctggaaaaagaggacttccctgaaggaactccaa

aagagttggcacgagaattgttcgctatgaacagaagccctgccaccatccctttggacctgcttagagccagagactac

ggcagtgatgtaaagaacaagagaattggtgccatcacaaagacacaggcaacgagttggggcgaatacttgacaggaaa

gatagaaagcttaactgagaggaaagttgcgacttgtgtcattcatggagctggaggttctggaaaaagtcatgccatcc

agaaggcattgagagaaattggcaagggctcggacatcactgtagtcctgccgaccaatgaactgcggctagattggagt

aagaaagtgcctaacactgagccctatatgttcaagacctctgaaaaggcgttaattgggggaacaggcagcatagtcat

ctttgacgattactcaaaacttcctcccggttacatagaagccttagtctgtttctactctaaaatcaagctaatcattc

taacaggagatagcagacaaagcgtctaccatgaaactgctgaggacgcctccatcaggcatttgggaccagcaacagag

tacttctcaaaatactgccgatactatctcaatgccacacaccgcaacaagaaagatcttgcgaacatgcttggtgtcta

cagtgagagaacgggagtcaccgaaatcagcatgagcgccgagttcttagaaggaatcccaactttggtaccctcggatg

agaagagaaagctgtacatgggcaccgggaggaatgacacgttcacatacgctggatgccaggggctaactaagccgaag

gtacaaatagtgttggaccacaacacccaagtgtgtagcgcgaatgtgatgtacacggcactttctagagccaccgatag

gattcacttcgtgaacacaagtgcaaattcctctgccttctgggaaaagttggacagcaccccttacctcaagactttcc

tatcagtggtgagagaacaagcactcagggagtacgagccggcagaggcagagccaattcaagagcctgagccccagaca

cacatgtgtgtcgagaatgaggagtccgtgctagaagagtacaaagaggaactcttggaaaagtttgacagagagatcca

ctctgaatcccatggtcattcaaactgtgtccaaactgaagacacaaccattcagttgttttcgcatcaacaagcaaaag

atgagaccctcctctgggcgactatagatgcgcggctcaagaccagcaatcaagaaacaaacttccgagaattcctgagc

aagaaggacattggggacgttctgtttttaaactaccaaaaagctatgggtttacccaaagagcgtattcctttttccca

agaggtctgggaagcttgtgcccacgaagtacaaagcaagtacctcagcaagtcaaagtgcaacttgatcaatgggactg

tgagacagagcccagacttcgatgaaaataagattatggtattcctcaagtcgcagtgggtcacaaaggtggaaaaacta

ggtctacccaagattaagccaggtcaaaccatagcagccttttaccagcagactgtgatgctttttggaactatggctag

gtacatgcgatggttcagacaggctttccagccaaaagaagtcttcataaactgtgagaccacgccagatgacatgtctg

catgggccttgaacaactggaatttcagcagacctagcttggctaatgactacacagctttcgaccagtctcaggatgga

gccatgttgcaatttgaggtgctcaaagccaaacaccactgcataccagaggaaatcattcaggcatacatagatattaa

gactaatgcacagattttcctaggcacgttatcaattatgcgcctgactggtgaaggtcccacttttgatgcaaacactg

agtgcaacatagcttacacccatacaaagtttgacatcccagccggaactgctcaagtttatgcaggagacgactccgca

ctggactgtgttccagaagtgaagcatagtttccacaggcttgaggacaaattactcctaaagtcaaagcctgtaatcac

gcagcaaaagaagggcagttggcctgagttttgtggttggctgatcacaccaaaaggggtgatgaaagacccaattaagc

tccatgttagcttaaaattggctgaagctaagggtgaactcaagaaatgtcaagattcctatgaaattgatctgagttat

gcctatgaccacaaggactctctgcatgacttgttcgatgagaaacagtgtcaggcacacacactcacttgcagaacact

aatcaagtcagggagaggcactgtctcactttcccgcctcagaaactttctttaaccgttaagttaccttagagatttga

ataagatggatattctcatcagtagtttgaaaagtttaggttattctaggacttccaaatctttagattcaggacctttg

gtagtacatgcagtagccggagccggtaagtccacagccctaaggaagttgatcctcagacacccaacattcaccgtgca

tacactcggtgtccctgacaaggtgagtatcagaactagaggcatacagaagccaggacctattcctgagggcaacttcg

caatcctcgatgagtatactttggacaacaccacaaggaactctaaccaggcactttttgctgacccttatcaggcaccg

gagtttagcctagagccccacttctacttggaaacatcatttcgagttccgaggaaagtggcagatttgatagctggctg

tggcttcgatttcgagaccaactcaccggaagaagggcacttagagatcactggcatattcaaagggcccctactcggaa

aggtgatagccattgatgaggagtctgagacaacactgtccaggcatggtgttgagtttgttaagccctgccaagtgacg

ggacttgagttcaaagtagtcactattgtgtctgccgcaccaatagaggaaattggccagtccacagctttctacaacgc

tatcaccaggtcaaagggattgacatatgtccgcgcagggccataggctgaccgctccggtcaattctgaaaaagtgtac

atagtattaggtctatcatttgctttagtttcaattacctttctgctttctagaaatagcttaccccacgtcggtgacaa

cattcacagcttgccacacggaggagcttacagagacggcaccaaagcaatcttgtacaactccccaaatctagggtcac

gagtgagtctacacaacggaaagaacgcagcatttgctgccgttttgctactgactttgctgatctatggaagtaaatac

atatctcaacgcaatcatacttgtgcttgtggtaacaatcatagcagtcattagcacttccttagtgaggactgaacctt

gtgtcatcaagattactggggaatcaatcacagtgttggcttgcaaactagatgcagaaaccataagggccattgccgat

ctcaagccactctccgttgaacggttaagtttccattgatactcgaaagaGGTCAGCACCAGCTAGCATCGATCGCGATA

TCGTCGACCGCCGATgaacggttaagtttccattgatactcgaaagatgtcagcaccagctagcacaacacagcccatag

ggtcaactacctcaactaccacaaaaactgcaggcgcaactcctgccacagcttcaggcctgttcaccatcccggatggg

gatttctttagtacagcccgtgccatagtagccagcaatgctgtcgcaacaaatgaggacctcagcaagattgaggctat

ttggaaggacatgaaggtgcccacagacactatggcacaggctgcttgggacttagtcagacactgtgctgatgtaggat

catccgctcaaacagaaatgatagatacaggtccctattccaacggcatcagcagagctagactggcagcagcaattaaa

gaggtgtgcacacttaggcaattttgcatgaagtatgctccagtggtatggaactggatgttaactaacaacagtccacc

tgctaactggcaagcacaaggtttcaagcctgagcacaaattcgctgcattcgacttcttcaatggagtcaccaacccag

ctgccatcatgcccaaagaggggctcatccggccaccgtctgaagctgaaatgaatgctgcccaaactgctgcctttgtg

aagattacaaaggccagggcacaatccaacgactttgccagcctagatgcagctgtcaCTCGAGGTCGTATCACTGGAAC

AACAACCGCTGAGGCTGTTGTCACTCTACCACCACCATAACTACGTCTACATAACCGACGCCTACCCCAGTTTCATAGTA

TTTTCTGGTTTGATTGTATGAATAATATAAATAAAAAAAAAAAAAAAAAAAAAAAACTAGTggtACCGAGCTCGATCGTT

CAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAAT

TACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATT

ATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTAC

TAGATCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAG

CACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAAT

GGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTAC

AATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGC

TCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAA

CGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGG

TGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGA

GACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATT

CCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTT

GGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTC

CAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGC

CGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAG

AGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGG

AGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATA

CCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTAC

TCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGG

CTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGT

AAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGAT

AGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATT

TTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCAC

TGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAAC

AAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA

GCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCT

ACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAG

ACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCT

ACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCG

GTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG

GTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACG

CGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGAT

AACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGA

AGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTC

CCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTT

ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGC

CAAGCTTGCATGCCTGCAGGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAG

AAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGT

CACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGA

AGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCA

CGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGAC

CCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA

pvx cDNA in 35s plasmid construct. PVX begins at 1-the 35s and nos ter junctions are uncharacterised.